Overview

Brief Summary

Introduction

This is the common inshore squid of the northeastern U.S. Maximum length: 47 cm ML (male); males grow larger than females; sizes in western central Atlantic are considerably smaller than in northern waters - males: 30 cm maximum, less than 20 cm average; females: less than 13 cm ML.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Habitat and Biology

North of Cape Hatteras there is a summer, inshore-northerly spawning migration to shallow coastal and shelf waters, followed by an offshore-southerly retreat in fall and winter to continental slope waters; restricted in summer to surface and shallow water, but from 28 - 366 m depth in winter (peak concentrations at 100 - 193 m); adults are found on the bottom during day but leave the bottom at night, dispersing into the water column, and may appear at the surface (in summer or warm water).

Optimum temperatures 10 - 14 C, minimum 8 C.

North of Cape Hatteras, spawning occurs in coastal waters and bays during late spring and summer and offshore near the shelf break during winter and early spring. Eggs laid in gelatinous finger-like strands, many of which are attached together in large masses (“sea mops”) to a solid substrate (rock, shells, man-made objects) at depths from a few to 250 m; planktonic paralarvae and juveniles are abundant in surface waters.

Food includes crustaceans (e.g. euphausids), fishes and squids.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Mantle
    1. Mantle long, moderately slender, cylindrical, the posterior end bluntly pointed.
  2. Fins
    1. Fins rhomboid, their sides nearly straight.
  3. Gladius
    1. Gladius long, rather wide, feather-shaped.
    2. Ratio of greatest width of vane of gladius to greatest width of rachis 2.7 to 3.7 in females, 2.4 to 2.9 in males.
    3. edge of vane curved (sometimes straight in males), thin, rarely ribbed.
  4. Eyes
    1. Eyes not unusually large, diameter of externally visible eyeball 8 to 18% mantle length, and diameter of dissected lens 2 to 6% mantle length.
  5. Arms
    1. Left ventral arm of mature males hectocotylized by modification of the distal third to fourth of arm, but the modification does not extend to arm tip; fewer than 12 of the suckers in dorsal row usually smaller than half the size of their counterparts in the ventral row; bases or pedicels of some of the modified suckers rounded, narrowly triangular.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Loligo pealeii is found from Newfoundland to the Gulf of Venezuela, migrating to different places to spawn. Among other places, these squid migrate to the Cape Cod area during the Spring and are also known as Woods Hole squid because they are studied at the Marine Biological Laboratory in Woods Hole, Massachusetts (Marine Biological Laboratory,2000).

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Distribution

Western Atlantic continental shelf and upper slope waters from Nova Scotia to Venezuela, including the Gulf of Mexico and the Caribbean Sea. Not occurring around islands, except as rare strays at islands close to continental shelf or slope.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These medium-sized squid grow to about 50 cm long. Like all squid, they have ten arms (eight of which are the same length, and one pair used for grabbing prey are longer) and three hearts (two close to their gills) so that they "can pump oxygen to the rest of the body easily." Their speed and maneuverability have earned them the description of "invertebrate athletes" (Squids,2000; Ellis, 34).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

This species lives in the waters along the eastern continental shelf of North America, and in the Gulf of Mexico. In comes into shallow waters near shore to lay eggs. (Marine Biological Laboratory, 2000)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9558 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5444 samples.

Environmental ranges
  Depth range (m): 1 - 735
  Temperature range (°C): 4.527 - 26.756
  Nitrate (umol/L): 0.289 - 27.038
  Salinity (PPS): 32.142 - 36.506
  Oxygen (ml/l): 2.469 - 6.920
  Phosphate (umol/l): 0.019 - 1.571
  Silicate (umol/l): 0.756 - 17.288

Graphical representation

Depth range (m): 1 - 735

Temperature range (°C): 4.527 - 26.756

Nitrate (umol/L): 0.289 - 27.038

Salinity (PPS): 32.142 - 36.506

Oxygen (ml/l): 2.469 - 6.920

Phosphate (umol/l): 0.019 - 1.571

Silicate (umol/l): 0.756 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 2 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 238 - 238
  Temperature range (°C): 8.801 - 8.801
  Nitrate (umol/L): 21.410 - 21.410
  Salinity (PPS): 35.074 - 35.074
  Oxygen (ml/l): 3.425 - 3.425
  Phosphate (umol/l): 1.441 - 1.441
  Silicate (umol/l): 14.096 - 14.096
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Loligo pealeii is carnivorous. Its diet includes chaetognaths, crustaceans, decapod shrimp, fishes, polychaetes, other squid, and euphausids.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Males court females (there is much communication by flashing skin colors), and if accepted by a female, use a modified arm (called a hectocotylus) to transfer a package of sperm called a spermatophore to the female. Females produce packets of about 200 eggs, and stick them to the sea floor in large groups with other females. Sometimes "sneaker" males lurk around the eggmasses, darting in to add their sperm as females lay their eggs. (MBL 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loligo pealeii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATATTTGGTATTTGAGCAGGGTTAGTAGGTACTTCATTGAGATTGATAATTCGTACAGAACTTGGAAAACCTGGTTCATTATTAAATGATGATCAATTATACAATGTAGTAGTTACTGCACACGGTTTCATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAACTGGTTAGTACCCTTAATATTAGGGGCCCCAGATATAGCCTTCCCCCGAATAAATAACATAAGATTTTGACTACTTCCACCTTCACTTACTCTTCTACTTGCATCCTCTGCAGTTGAAAGGGGGGCCGGAACAGGTTGAACAGTTTACCCCCCATTATCTAGTAACCTTTCCCACGCCGGGCCTTCAGTAGACCTCGCAATTTTCTCACTCCACCTAGCTGGTATCTCTTCTATTTTAGGGGCTATTAACTTTATTACAACTATCATAAATATACGATGAGAAGGCTTATTAATGGAACGACTTTCCTTATTTGTTTGGTCAGTATTCATTACTGCCATTCTTCTCCTTTTATCCTTACCAGTATTGGCTGGTGCTATTACAATATTACTTACTGACCGTAACTTTAACACTACCTTCTTTGACCCAAGAGGGGGAGGAGACCCTATTCTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loligo pealeii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Loligo pealei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGGANCATTATATTTTATATTTGGTATTTGAGCAGGGTTAGTAGGTACTTCATTGAGATTGATAATTCGTACAGAACTTGGAAAACCTGGTTCATTATTAAATGAT---GATCAATTATACAATGTAGTAGTTACTGCACACGGTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGGTTAGTACCCTTAATATTAGGGGCCCCAGATATAGCCTTCCCCCGAATAAATAACATAAGATTTTGACTACTTCCACCTTCACTTACTCTTCTACTTGCATCCTCTGCAGTTGAAAGGGGGGCCGGAACAGGTTGAACAGTTTACCCCCCATTATCTAGTAACCTTTCCCACGCCGGGCCTTCAGTAGACCTCGCAATTTTCTCACTCCACCTAGCTGGTATCTCTTCTATTTTAGGGGCTATTAACTTTATTACAACTATCATAAATATACGATGAGAAGGCTTATTAATGGAACGACTTTCCTTATTTGTTTGGTCAGTATTCATTACTGCTATTCTTCTCCTTTTATCCTTACCAGTATTGGCTGGTGCTATTACAATATTACTTACTGACCGTAACTTTAACACTACCTTCTTTGACCCAAGAGGGGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loligo pealei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This species is vulnerable to overfishing, and the U.S. National Oceanic and Atmospheric Administration's Northeast Fisheries Center has helped establish catch limits to protect the population (Cadrin 2000).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

This species of squid is very important to fishing industries throughout the world, including the United States, where a big market exists for this animal in both commercial and recreational fishing. In commercial fishing, Longfin inshore squid are sold to restaurants and other stores. In recreational fishing they serve as bait to catch to fish such as Mahi-mahi, Swordfish, and Marlins (Cadrin 2000, von der Linden et al. 1998).

Loligo pealeii is also used as specimen in neurobiology research. Its neurons, one thousand times larger than their counterparts in humans, have provided scientists ample opportunity to study such things as sodium and potassium ion pumps. The study of these neurons has helped scientists better understand heart disease, cancer, Alzherimer's Disease, and kidney disease (Marine Biological Laboratory, 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Longfin inshore squid

The longfin inshore squid (Doryteuthis pealeii) is a species of squid of the family Loliginidae.

Contents

Description

This species of squid is often seen with a reddish hue but like many types of squid they can manipulate their color so they can vary in color from a deep red to a soft pink. The dorsal mantle length of some males can reach up to 50 cm, although most squids commercially harvested are smaller than 30 cm long. This species exhibits sexual dimorphism, with most males growing faster and reaching larger sizes than females.

Specimen with tentacles outstretched
The gladius of a longfin inshore squid

Distribution

The longfin inshore squid is found in the North Atlantic, schooling in continental shelf and slope waters from Newfoundland to the Gulf of Venezuela. It is commercially exploited, especially in the range from the Southern Georges Bank to Cape Hatteras. The population makes seasonal migrations that appear to be related to bottom water temperatures; they move offshore during late autumn to overwinter along the edge of the continental shelf and return inshore during the spring and early summer (MAFMC 1998).

Diet

"The diet of the longfin inshore squid changes with size; small immature individuals feed on planktonic organisms while larger individuals feed on crustaceans and small fish. Studies showed that juveniles fed on euphausiids and arrow worms, while older individuals fed mostly on small crabs, but also on polychaetes and shrimp. Adults fed on fish (clupeids, myctophids) and squid larvae/juveniles, and those larger than 16 cm fed on fish and squid. Fish species preyed on by longfin inshore squid include silver hake, mackerel, herring, menhaden, sand lance, bay anchovy, menhaden, weakfish, and silversides. Maurer and Bowman (1985) discovered a differences in inshore/offshore diet: in offshore waters in the spring, the diet is composed of crustaceans (mainly euphausiids) and fish; in inshore waters in the fall, the diet is composed almost exclusively of fish; and in offshore waters in the fall, the diet is composed of fish and squid. Cannibalism is observed in individuals larger than 5 cm."[1]

Predators

Many pelagic and demersal fish species, as well as marine mammals and diving birds, prey upon juvenile and adult longfin inshore squid. Marine mammal predators include longfin pilot whales and common dolphins. Fish predators include bluefish, sea bass, mackerel, cod, haddock, pollock, silver hake, red hake, sea raven, spiny dogfish, angel shark, goosefish, dogfish, and flounder.

Reproduction

The longfin inshore squid spawns year-round and lives for less than one year. "Eggs are demersal. Enclosed in a gelatinous capsule containing up to 200 eggs. Each female lays 20-30 capsules. Fecundity ranges from 950–15,900 eggs per female. Laid in masses made up of hundreds of egg capsules from different females."[1] Individuals hatched in summer generally grow more rapidly than those hatched in winter due to the warmer temperature of the water. The lifespan of a typical specimen is normally less than one year.

Research

This species is a model organism in neuroscience and was used by Andrew Huxley and Alan Hodgkin in their studies on axons. They are also used for research on replicating their camouflage abilities due to the chromatophores in their skin, which reflect a different color depending on the angle at which the light is hitting them. A dead longfin can show a colourful display with its chromatophores by connecting its axons to a music player.[1][2][3]

References

  1. ^ a b c [1] NOAA Longfin Inshore Squid, Loligo pealeii, Life History and Habitat Characteristics retrieved: Dec. 26, 2012
  2. ^ "MBL Scientists Discover Nerves Control Iridescence in Squid’s Remarkable “Electric Skin”" Marine Biological Laboratory, 24 August 2012. Retrieved: 2 September 2012.
  3. ^ Kenney, Diane. "Insanely Popular: MBL Squid Research/Rap Video Goes Viral" Marine Biological Laboratory, 31 August 2012. Retrieved: 2 September 2012.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!