Overview

Brief Summary

Introduction

The common loliginid of western North America. Maximum size 19 cm dorsal mantle length and 130 g weight in males, 17 cm and 90 g respectively in females; average total length about 30 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Minimum size at spawning ranges between 8 and 12 cm in females, and between 7 and 11 cm in males.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Mantle
    1. Mantle slender, width 20-33% ML.
  2. Fins
    1. Fin length and width approximately equal, 38-52% ML.
  3. Arms
    1. Arms short.
    2. Arm sucker rings with 9 to 12 blunt teeth.
    3. Left ventral arm hectocotylized along distal 1/3 by great reduction in sucker size and enlargement of stalks into papillae.
  4. Tentacles
    1. Tentacular clubs narrow, unexpanded.
    2. Sucker rings with about 30 blunt teeth.
  5. Viscera
    1. Ink sac elongate.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic distribution

Endemic to the California Current region. Range from British Columbia, Canada to southern tip of Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Loligo opalescens Berry, 1911
Catalog Number: USNM 816384
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Isopropyl Alcohol
Year Collected: 1909
Locality: Puget Sound, Washington, United States, North Pacific Ocean
  • Paratype: Berry, S. 1911. Proc. U.S. Natl. Mus. 40(1838): 591.; Berry, S. S. 1911. Proc. U.S. Natl. Mus. 40(1838): 591.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Loligo opalescens Berry, 1911
Catalog Number: USNM 214388
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Isopropyl Alcohol
Year Collected: 1909
Locality: Puget Sound, Washington, United States, North Pacific Ocean
  • Paratype: Berry, S. 1911. Proc. U.S. Natl. Mus. 40(1838): 591.; Berry, S. S. 1911. Proc. U.S. Natl. Mus. 40(1838): 591.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 231 specimens in 1 taxon.
Water temperature and chemistry ranges based on 153 samples.

Environmental ranges
  Depth range (m): 0 - 572
  Temperature range (°C): 6.452 - 10.151
  Nitrate (umol/L): 6.725 - 30.351
  Salinity (PPS): 31.893 - 33.811
  Oxygen (ml/l): 2.565 - 6.561
  Phosphate (umol/l): 0.943 - 2.595
  Silicate (umol/l): 15.658 - 46.900

Graphical representation

Depth range (m): 0 - 572

Temperature range (°C): 6.452 - 10.151

Nitrate (umol/L): 6.725 - 30.351

Salinity (PPS): 31.893 - 33.811

Oxygen (ml/l): 2.565 - 6.561

Phosphate (umol/l): 0.943 - 2.595

Silicate (umol/l): 15.658 - 46.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 338 specimens in 1 taxon.
Water temperature and chemistry ranges based on 269 samples.

Environmental ranges
  Depth range (m): 2.31 - 899.56
  Temperature range (°C): 4.156 - 13.353
  Nitrate (umol/L): 3.951 - 44.033
  Salinity (PPS): 33.310 - 34.416
  Oxygen (ml/l): 0.435 - 6.095
  Phosphate (umol/l): 0.674 - 3.258
  Silicate (umol/l): 5.723 - 114.188

Graphical representation

Depth range (m): 2.31 - 899.56

Temperature range (°C): 4.156 - 13.353

Nitrate (umol/L): 3.951 - 44.033

Salinity (PPS): 33.310 - 34.416

Oxygen (ml/l): 0.435 - 6.095

Phosphate (umol/l): 0.674 - 3.258

Silicate (umol/l): 5.723 - 114.188
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Doryteuthis opalescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGACTATTCTCCACAAATCATAAAGATATTGGAACATTATATTTTATATTCGGTATTTGAGCAGGGCTAGTAGGTACATCATTAAGATTGATAATCCGTACAGAGTTAGGGAAACCTGGCTCCTTATTAAATGATGATCAATTATACAATGTAGTAGTTACTGCACATGGTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTACCTTTAATATTAGGTGCTCCAGACATAGCCTTTCCTCGAATAAACAACATAAGATTTTGACTATTACCACCTTCACTCACTCTTCTTTTAGCATCCTCGGCTGTTGAAAGCGGAGCCGGAACAGGTTGAACAGTCTACCCACCCCTATCTAGAAATCTCTCTCATGCTGGTCCTTCAGTAGACCTCGCCATTTTCTCACTTCACTTAGCAGGTATCTCCTCTATTTTAGGGGCTATTAACTTTATCACAACTATTATAAATATACGATGAGAAGGTCTATTAATAGAACGACTCTCTTTATTTATCTGATCAGTATTTATTACTGCTATCCTATTACTACTATCCCTTCCAGTTCTAGCAGGTGCTATTACAATACTTTTAACTGACCGAAATTTTAATACTACTTTCTTTGACCCTAGTGGAGGAGGAGATCCTATTCTCTACCAACACTTATTTTGATTTTTTGGGCACCCAGAAGTTTATATTCTAATTTTACCTGCATTTGGTATTATTTCTCACATTGTATCCCACCACTCTTTTAAAAAAGAAATTTTTGGTACACTAGGAATAATCTATGCAATACTCTCCATTGGCCTATTAGGATTTATTGTGTGAGCACACCATATATTTACTGTAGGAATAGACGTAGATACTCGAGCCTATTTTACCTCTGCAACAATAATTATTGCGATTCCTACAGGAATCAAAGTATTTAGTTGATTAGCAACAATTTACGGTTCCCCTGTTAAATATAACACTCCTATGATATGAGCTCTAGGCTTTATTTTTCTATTCACAGTAGGAGGCTTAACAGGAATTATTTTATCAAACTCCTCCCTAGATATTATGCTTCACGACACTTATTATGTAGTAGCCCACTTCCATTATGTACTTTCAATAGGAGCAGTATTTGCACTATTTGCTGGATTTAACCACTGATACCCATTATTTACAGGCCTAACGCTTAATCAACAATGAACAAAAACACACTTCATACTTATATTTTTAGGAGTAAACATCACTTTCTTTCCTCAACACTTCTTAGGTCTAGCTGGAATACCCCGACGATACTCGGATTACCCTGACTGTTACACAAAATGGAACATAGTTTCATCTATAGGATCAATATTATCTCTAACTAGAGTTTTATTTTTTATTTTTATCGTATGAGAAAGACTAATTTCTCAGCGAACAGTAGTATGATCTAATCACCTTTCTCCTTCCTTAGAATGAGATAACCGATTACCCGTTGACTTCCACAGCCTATCCGAAACTGGAGCAATTTACGTCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Doryteuthis opalescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Loligo opalescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTCGGTATTTGAGCAGGGCTAGTAGGTACATCATTA---AGATTGATAATCCGTACAGAGTTAGGGAAACCTGGCTCCTTATTAAATGAT---GATCAATTATACAATGTAGTAGTTACTGCACATGGTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTACCTTTAATA---TTAGGTGCTCCAGACATAGCCTTTCCTCGAATAAACAACATAAGATTTKGACTATTACCACCTTCACTCACTCTTCTTTTAGCATCCTCGGCTGTTGAAAGCGGA---GGAACAGGTTGAACAGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACC---------------------------------------------------------------------------------------------------------ACC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loligo opalescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The Loligo opalescens, also known as the California market squid, is a squid species that is a household name in the restaurant and fishery business. About 90% of the calamari that is served to consumers in the world is from this species (National Marine Fisheries Service, 2010). It was estimated that 203.5 million pounds of market squid in the California waters was harvested in 2009. They provide many nutrients, such as selenium riboflavin, and vitamin B12. They are also a crucial food source for a variety of other organisms, such as fish, birds, and marine mammals (National Marine Fisheries Service, 2010).

Loligo opalescens are fast-growing, yet short-lived (Jackson and Domeier, 2003). They live to about one year, then reproduce and die shortly after. They spawn all year round and in all depth ranges of the southern tip of Baja California to southeastern Alaska. The northern fishery season occurs from April through November and the southern fishery season occurs from October to March. The squid species is able to replace itself annually and so far has shown to be able to handle high amounts of fishing pressure (National Marine Fisheries Service, 2010).

In the 1990s, the Loligo opalescens value increased in price and catch, making them very valuable for the fishery in California (Vojkovich, 1998). This has also made them a target for recreational interests as well (National Marine Fisheries Services, 2010). To ensure that the Loligo opalescens species are a continual and viable living resource, the California Department of Fish and Game (CDFG) is responsible for managing the market squid fishery to comply with the Coastal Pelagic Species Fishery Management Plan. This is done by implementing seasonal catch limits, time and seasonal closures, monitoring programs, and permit systems (Forsythe, 2004; National Marine Fisheries Services, 2010).

Public Domain

Anoka Ramsey Community College

Source: Anoka Ramsey Community College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Doryteuthis opalescens

Doryteuthis opalescens, the opalescent inshore squid, is a small squid (mantle length (ML) up to 190 mm) in the family Loliginidae. It is a myopsid squid, which is the near shore group and that means that they have corneas over their eyes. The species lives in the Eastern Pacific Ocean from Mexico's Baja California peninsula to Alaska, USA, within 200 miles[vague] (320 kilometers) of shore.

Contents

Description

Dorsal (top) and ventral views of adult

Adult Doryteuthis opalescens can reach a total size of 28 cm. Males are typically larger with a mantle length of 13-19 cm, while females are 12-18 cm in mantle length.[1] The mantle of L. opalescens is not fused to the head and its body is 4 to 5 times longer than it is wide, with fins equal in both length and width. This squid has 8 arms with 2 longer tentacles ending in tentacular clubs equipped with suckers at their ends. The tentacular clubs are narrow with 4 rows of suckers and 2 large rows in the center of the tentacular club bordered by outer rows of smaller suckers. The 8 arms have only 2 rows of alternating suckers running down their length.[2] In male D. opalescens, the left ventral arm is specialized or “hectocotylized” for spermatophore transfer during mating.[1] The eyes of L. opalescens are covered with a non-perforated membrane known as a cornea which is a signature of myopsid squid.[1] The color of L. opalescens can range from white to brown, with the animals able to change their color shades using chromatophores depending on mood and for camouflage. They are normally a bluish-white to mottled brown and gold, and they change to dark red or brown when excited, frightened or feeding.[1]

Misidentification

D. opalescens is very similar to two other species of squid in the same genus: Loligo pealeii from the North Atlantic Coast of North America, and Loligo gahi from the coast of Chile.[3]

Life history

The life cycle of L. opalescens has four stages: eggs, hatchlings (called paralarvae), juveniles, and adults. Squid live for 6–9 months. L. opalescens eggs are laid on sandy bottom substrates in 10–50 m depth, although there is a report of a shrimp trawler pulling up eggs from 400 fathoms (730 m). Females encapsulate hundreds of eggs in a sheath that is made of many layers of protein. Bacteria grow between the layers and may serve as an antibiotic for fungal infection. Females insert the egg capsules into the sand with a sticky substance that anchors them in place so that the ocean surge can ventilate them. The presence of eggs on the bottom of tanks stimulates females to lay more eggs. Groups of capsules are placed in masses that can extend into egg beds. Some egg beds can cover acres of the ocean floor. The eggs take 3-8 weeks to hatch with warmer water shortening the incubation time. Bat Stars (Asterina miniatus) are the most prevalent predators of eggs. Fish do not eat them, although they will nip at eggs not covered by the capsule sheath. There is no brooding.

Doryteuthis opalescens paralarva

Paralarvae of L. opalescens hatch from the eggs and immediately begin swimming. Where they go is unknown, but hatchlings of the closely related Loligo pealei swim to the surface in the first 12 hours post-hatching. Paralarvae must rapidly learn to hunt, as their yolk is either used up or detached upon escaping from the egg sheath. Through a series of trial and error as these 2–3 mm ML hatchlings learn to eat copepods and other plankton in the first months of their lives. They are found in the greatest abundance at 15 m depth by night and 30 m depth by day. Thus, they perform a daily vertical migration of 15 meters, no small feat a creature only 3 mm long. This daily migration coupled with the shear zone created by tidal and near-shore currents cause the hatchlings to become entrained within 3 kilometers of shore. That is good for them because in the near-shore environment the plankton is smaller and easier for them to eat.

By the time L. opalescens reaches 15 mm mantle length (about 2 months old) they are strong enough to swim in shoals. These juveniles form groups of tens of individuals and swim over the shelf in search of food. Those that have survived to this point can hunt with the tentacular strike as seen in the adults. At some point between 4–8 months their sexual organs mature and they are now considered adults. Sexually mature animals can be 70-160 mm ML and weigh about 40 grams.

Adult L. opalescens move off the continental shelf by day and can be found to depths of 500 m. Adult shoals return to the surface at night to hunt. At some point these shoals move on shore to spawn where aggregations can reach million of individuals. Originally it was thought that the adults died after spawning, as the egg beds were often littered with dead squid. Now there is debate as to how long adults live after their first egg deposition and whether they can spawn repeatedly over the last weeks or months of their lives.

Predator and prey relationships

Adult Doryteuthis opalescens

L. opalescens is a cannibalistic predator that feeds on smaller prey species such as fish, crabs and shrimp, mollusks, and other juvenile squid.[1] It uses its two longer tentacles with tentacular clubs on the end to snare and catch its prey. L. opalescens itself is an important food source for many predators like larger fish, sharks, marine mammals, sea birds, and also humans. Its predators include the Common Seal, California Sea Lion, Blue shark, Chinook salmon, Black-throated Diver, and Brandt's Cormorant.

The fishery for L. opalescens began with the Chinese in Monterey Bay, California in 1860. By the turn of the century Italian fishermen had assumed the leading role. After World War II there was a resurgence in squid fishing. Since 1981 the fishery has grown significantly, as effort in Southern California has increased. Now Southern California, mostly areas around the Channel Islands, comprises 90% of the squid landings. The fishery in Monterey Bay occurs from April to November coinciding with the upwelling season. In Southern California landings begin in November and continue through April correlated with the greater mixing of winter storms. Since 1993 squid has been the #1 fishery in California with landings of 118,000 tons[vague] and $41 million in 2000. The population fluctuates greatly with the El Niño. During these warm water and nutrient poor years landings can disappear entirely in certain areas.

References

  1. ^ a b c d e Morris, Robert H., Donald P. Abbott, Eugene R. Haderlie. 1980. Intertidal Invertebrates of California. Stanford: Stanford University Press.
  2. ^ Kozloff, Eugene N. 1996. Marine Invertebrates of the Pacific Northwest. Seattle: University of Washington Press.
  3. ^ Berry, S. Stillman. 1910. “A Review of the Cephalopods of Western North American.” Bulletin of the Bureau of Fisheries 30: 294–297.
  • Vecchione, M., E. Shea, S. Bussarawit, F. Anderson, D. Alexeyev, C.-C. Lu, T. Okutani, M. Roeleveld, C. Chotiyaputta, C. Roper, E. Jorgensen & N. Sukramongkol. (2005). Systematics of Indo-West Pacific loliginids. PDF Phuket Marine Biological Center Research Bulletin 66: 23–26.
  • Opalescent inshore squid NOAA FishWatch. Retrieved 4 November 2012.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!