Overview

Brief Summary

Biology

Cuttlefish swim using the fin that passes around the body. They can also rapidly expel water and move quickly by 'jet-propulsion' (4). Like all cephalopods, the common cuttlefish is an active predator, feeding on molluscs, young fish, and crabs. Other species of cuttlefish may also be taken, and cannibalism has been reported (2). When threatened, this species releases ink (known as sepia) into the water to produce a protective 'cloud' which confuses predators and allows the cuttlefish to escape (4). During spring and summer, males and females migrate to warmer water in order to spawn (2). Males often engage in spectacular displays to attract a female, in which bands of colour pass rapidly along the body; fighting over females is common (4). The eggs are attached to objects on the sea floor such as shells and seaweeds (2); after spawning, both the males and females die (4). Young cuttlefish reach maturity at 14-18 months of age, and the average life span is 1-2 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Body relatively broad and somewhat flattened so as to be oval in cross section. Paired fins run from behind the head to the tip of the body, but do not join. Arms are short and possess 4 rows of suckers while tentacular clubs possess 5-6 suckers in transverse rows. Dorsal margin of mantle with blunt lobe. Individuals are capable of very rapid colour change, especially when threatened; the animal may also take the colour or patterning of its background. Mantle reaching lengths up to 45 cm and weight up to 4 kg.
  • Males larger than females, and slightly more frequent (Dunn, 1999).
  •   
  • Sepia elegans is smaller, has 2 rows of suckers on arms and has an acute lobe on its dorsal mantle margin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cephalopods (meaning 'head-footed'), a group of molluscs containing the octopuses, squid and cuttlefish, are probably the most intelligent of all invertebrates. They have well-developed heads, with large eyes and mouths that feature beak-like jaws (3). The body of the common cuttlefish is flattened and broad, and is therefore oval in cross-section (2). A fin runs around the body from behind the head (2). Encircling the mouth there are eight 'arms' with suckers, which are used to manipulate prey, there are also two tentacles with flattened paddle-like tips, which can be rapidly extended and are used to catch prey (4). This species has excellent camouflage; it is able to change its colour to match its surroundings (2). Colour is therefore extremely variable, but is typically blackish-brown, mottled or striped, usually with paler underparts (2). Cuttlefish have an internal shell known as a cuttlebone, which is filled with gas and aids buoyancy; these shells are found washed ashore, and are often given to pet birds as a source of calcium and other minerals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Sepia officinalis is generally found in the eastern North Atlantic, throughout the English Channel, and south into the Mediterranean Sea so it is often referred to as the "European Cuttlefish". However, populations have also been recorded along the west coast of Africa, and as far south as South Africa.

Biogeographic Regions: atlantic ocean (Native ); mediterranean sea (Native )

  • Jereb, P., C. Roper. 2005. Cephalopods of the world. An annotated and illustrated catalogue of cephalopod species known to date. Volume 1. Chambered nautiluses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae).. FAO Species Catalogue for Fishery Purposes, 1 (4): 1-262. Accessed December 10, 2010 at http://marinebio.org/cephs/FAO/A0150e00.pdf.
  • King, A. 2009. "Sepia officinalis, the common cuttlefish" (On-line). The Cephalopod Page. Accessed December 10, 2010 at http://www.thecephalopodpage.org/Soffic.php.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Coast, Belgian Continental Shelf, Belgian Exclusive Economic Zone, British Isles, Calais, De Haan, Dutch Exclusive Economic Zone, East Atlantic, European waters (ERMS scope), FAO fishing area 27, FAO fishing area 34, FAO fishing area 37, Greek Exclusive Economic Zone, Koksijde, Mediterranean Sea, Nice, North East Atlantic, Oostduinkerke, Oostende, Oosterschelde, South West Indian Ocean, United Kingdom Exclusive Economic Zone, Wimereux, Zeebrugge
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In Britain, this cuttlefish is found around southern and western coasts. Elsewhere, the species is found in the eastern Atlantic from the Baltic Sea to South Africa, and also in the Mediterranean (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sepia officinalis measures up to 45 cm in mantle length, ranging from 30 cm in subtropic areas to 49 cm in temperate areas. Weights are between 2 kg (subtropic areas) and 4 kg (temperate areas). The largest recorded individual reached a mantle length of 60 cm. European cuttlefish have large eyes and a mouth with beak like jaws located at the base of the mantle. The mantle houses reproductive and digestive organs, as well an internal shell called the cuttlebone. The cuttlebone shape is oblong with a rounded posterior end and an anterior end that tapers to a point.

The body of S. officianalis is broad and dorso-ventrally flattened, having an oval shaped cross section. A pair of flat, wide fins runs the length of the mantle. The mouth is surrounded by eight arms and two longer tentacles, all equipped with suckers. Mature Sepia officinalis exhibit a zebra stripe pattern on the dorsal surface of their mantles during breeding season. Adult males are distinguished by white and black zebra bands on their fourth arm, as well as white arm spots. Sepia officinalis is able to change the color and even texture of its skin using structures called chromatophores, leucophores, and iridophores. These structures function to camouflage this species to its variable surroundings. Generally, however, Sepia officinalis has a mottled black or brown color.

Range mass: 2 to 4 kg.

Range length: 60 (high) cm.

Average length: 45 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike; sexes colored or patterned differently

  • Wildscreen. 2003. "Common cuttlefish- Sepia officinalis" (On-line). ARKive. Accessed December 10, 2010 at http://www.arkive.org/common-cuttlefish/sepia-officinalis/.
  • Marine Bio Conservation Society. 2010. "Cuttlefish, Sepia officinalis at Marine Bio" (On-line). Accessed December 10, 2010 at http://marinebio.org/species.asp?id=540.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Sepia officinalis is a marine organism, categorized as a “shallow water cephalopod”, dwelling in sandy or muddy substrates. Its habitat ranges from subtidal waters to depths of 200 meters. Members of this species follow seasonal migrations. They spend spring and summer in inshore waters, then migrate to depths of 100 m to 200 m during autumn and winter. Sepia officinalis commonly spends the daytime hidden in sand.

Range depth: 0 to 200 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic ; coastal

  • Neves, A., H. Cabral, V. Sequeria. 2009. Distribution patterns and reproduction of the cuttlefish, Sepia officinalis in the Sado estuary. Journal of the Marine Biological Association of the United Kingdom, 89: 579-584.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

shelf
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 343 specimens in 3 taxa.
Water temperature and chemistry ranges based on 152 samples.

Environmental ranges
  Depth range (m): 5 - 342
  Temperature range (°C): 6.946 - 19.658
  Nitrate (umol/L): 0.729 - 19.934
  Salinity (PPS): 34.662 - 38.091
  Oxygen (ml/l): 4.078 - 6.244
  Phosphate (umol/l): 0.091 - 1.550
  Silicate (umol/l): 1.778 - 14.027

Graphical representation

Depth range (m): 5 - 342

Temperature range (°C): 6.946 - 19.658

Nitrate (umol/L): 0.729 - 19.934

Salinity (PPS): 34.662 - 38.091

Oxygen (ml/l): 4.078 - 6.244

Phosphate (umol/l): 0.091 - 1.550

Silicate (umol/l): 1.778 - 14.027
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Found on sandy and muddy substrata, shallow sublittoral and offshore to 200 m, but typically to 100 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Occurs from the shallow sublittoral zone to depths of 200m, where it is found on muddy and sandy substrates (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Sepia officinalis preys upon a wide variety of animals. It primarily feeds on crustaceans and fish, but has also been known to eat gastropods, nemertean worms, polychaetes and even other cuttlefish. Sepia officinalis is an ambush predator that hunts by blending in with its background and sneaking up on prey. When the prey is close, Sepia officinalis has two modes of attack. One is to shoot out its two longer tentacles, grab the prey using the suckers on the tentacular clubs at the tips of the tentacles and bring the prey into its beak to feed. The other attack mode is pounce on its prey and use its arms to capture and maneuver the prey while it tears at the prey with its radula and beak. Both adult and immature cuttlefish hunt for food during the night. Some studies have shown that cuttlefish embryos have the ability to learn about prey items while still encased in their eggs using their fully-developed eyes to observe prey species. Hatchlings that observed crabs while inside their eggs preferred to eat crab over other prey items.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Vermivore)

  • Boletzky, S., R. Hanlon. 1983. A review of the laboratory maintenance, rearing and culture of cephalopod molluscs. Memoirs of the Museum of Victoria, 44: 147-187.
  • Mangold, K., R. Young. 1996. "Sepiidae" (On-line). Tree of Life Project. Accessed December 10, 2010 at http://tolweb.org/tree?group=Sepiidae.
  • Walker, M. 2008. "Cuttlefish spot target prey early" (On-line). BBC News. Accessed December 10, 2010 at http://news.bbc.co.uk/2/hi/science/nature/7435757.stm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Sepia officinalis is highly active, grows quickly and expends high amounts of energy per reproductive effort. In order to meet its energetic needs, a cuttlefish will eat voraciously. Therefore, cuttlefish play an important ecological role as consumers. Because they eat a wide variety of prey and can be highly mobile, cuttlefish can fill a broad and flexible ecological niche.

  • Wood, J. 2009. "Cuttlefish husbandry: Part I - What is a cuttlefish anyway?" (On-line). The Cephalopod Page. Accessed December 10, 2010 at http://www.thecephalopodpage.org/cuttle1.php.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sepia officinalis is prey for large fish, seals, sharks, dolphins and whales. The cuttlefish avoids predation by camouflaging with its environment, disorienting predators by releasing ink when threatened, and propelling itself away from danger.

Known Predators:

  • sharks
  • dolphins and toothed whales (Odontoceti)
  • large fish
  • seals
  • sea lions and fur seals

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Sepia officinalis has highly developed eyes and often communicates with other cuttlefish and predators using visual cues. Not only does it use its skin-changing ability to convey messages, but it also communicates by swimming in certain patterns or holding its tentacles in certain postures. In addition to communicating by altering its skin’s appearance, a cuttlefish can also indicate that it feels threatened by ejecting black ink from its siphon.

Communication Channels: visual

Perception Channels: visual ; tactile

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Females deposit clusters of eggs on seaweed, shells, and other substrate along the seafloor. Eggs measure 6 to 9 mm in diameter, hatching after about 2 months, or 30-90 days, depending on water temperature. Once hatched, the young Sepia officinalis have a total length of 50 mm. Newly hatched young are well developed and can almost immediately start feeding on small prey. Growth rates vary with temperature, the young growing faster at lower temperatures. Sepia officinalis generally reaches maturity at 14 to 18 months of age.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sepia officinalis has a typical lifespan of one to two years.

Typical lifespan

Status: wild:
1 to 2 years.

Typical lifespan

Status: captivity:
1 to 2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Sepia officinalis has separate male and female sexes. In the spring and summer, male and females migrate to shallow, warmer waters to spawn. They exhibit elaborate courtships, wherein males attract females through spectacular displays of colored bands passing rapidly along their bodies. Males then hold their arms stiffly in a basket formation to show their virility. Similarly, females display a uniform gray color when ready to mate. Mate guarding, in which males aggressively fight over and guard their females, is also common.

Mating System: polygynous

Mating in Sepia officinalis involves internal fertilization. The male deposits spermaphores into the female’s buccal membrane using a hectocotylized arm (tentacle arm used as intromittent organ). Males carry as many as 1400 spermatophores, while females carry somewhere between 150 and 4000 eggs, depending on body size. Sepia officinalis reaches sexual maturity at 14 to 18 months of age. Females can lay eggs several times at the ends of their lives. However, after spawning both male and females die.

Breeding interval: European cuttlefish typically breed only once in their lifetime.

Breeding season: European cuttlefish breed during the spring and summer.

Range number of offspring: 100 to 1000.

Range gestation period: 30 to 90 days.

Range age at sexual or reproductive maturity (female): 14 to 18 months.

Range age at sexual or reproductive maturity (male): 13 to 18 months.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Fertilized eggs are stored in the oviduct of the female Sepia officinalis until they are ready to be deposited. Eggs are produced with deposits of ink, to color and, therefore, camouflage the eggs for protection. A young Sepia officinalis hatches with a yolk to provide nutritious support until they are able to catch their own prey.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female)

  • Wildscreen. 2003. "Common cuttlefish- Sepia officinalis" (On-line). ARKive. Accessed December 10, 2010 at http://www.arkive.org/common-cuttlefish/sepia-officinalis/.
  • Marine Bio Conservation Society. 2010. "Cuttlefish, Sepia officinalis at Marine Bio" (On-line). Accessed December 10, 2010 at http://marinebio.org/species.asp?id=540.
  • Hart, S. 2010. "ACP- Cephalopods" (On-line). The Animal Communication Project. Accessed December 10, 2010 at http://acp.eugraph.com/cephal/.
  • Jereb, P., C. Roper. 2005. Cephalopods of the world. An annotated and illustrated catalogue of cephalopod species known to date. Volume 1. Chambered nautiluses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae).. FAO Species Catalogue for Fishery Purposes, 1 (4): 1-262. Accessed December 10, 2010 at http://marinebio.org/cephs/FAO/A0150e00.pdf.
  • King, A. 2009. "Sepia officinalis, the common cuttlefish" (On-line). The Cephalopod Page. Accessed December 10, 2010 at http://www.thecephalopodpage.org/Soffic.php.
  • Neves, A., H. Cabral, V. Sequeria. 2009. Distribution patterns and reproduction of the cuttlefish, Sepia officinalis in the Sado estuary. Journal of the Marine Biological Association of the United Kingdom, 89: 579-584.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sepia officinalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 267 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCPH0048-06|AB240155|Sepia officinalis| ATGCGATGATTATTCTCAACAAATCACAAAGATATTGGAACATTATATTTCATTTTTGGTATTTGATCAGGTTTATTAGGCACCTCGCTA---AGATTAATAATTCGAAGAGAGTTGGGTAAACCTGGTACACTTTTAAATGAC---GACCAACTTTATAATGTTGTAGTAACTGCCCATGGTTTTATTATAATTTTTTTTTTAGTTATACCTATTATAATTGGGGGGTTTGGTAATTGGCTGGTCCCTTTAATA---TTAGGTGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGGTTATTACCTCCATCACTAACCCTTTTACTATCCTCGTCCGCAGTTGAAAGGGGGGCCGGAACAGGTTGAACAGTTTACCCCCCTTTATCTAGTAACTTATCTCATGCGGGCCCCTCAGTAGATTTA---GCTATCTTCTCCTTACATTTAGCAGGAGTCTCATCAATTTTAGGAGCGATTAACTTCATCACAACTATTCTAAATATACGATGAGAAGGTCTACAAATAGAACGCCTACCTTTATTTGCTTGATCGGTATTTATTACTGCTATTTTATTACTACTCTCCCTCCCTGTATTAGCAGGA---GCTATTACAATATTATTAACTGACCGAAACTTTAATACTACTTTTTTCGATCCTAGGGGAGGCGGAGACCCTATTTTATACCAACACTTGTTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTCTGCCTGCGTTTGGTATTATTTCACATATTGTCTCTCATCATTCTTTTAAAAAA---GAGACTTTTGGCTCTTTAGGTATAATTTACGCAATATTATCCATCGGTTTACTAGGTTTTATTGTATGAGCTCACCATATGTTTACTGTGGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sepia officinalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 267
Species: 267
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

This species of cuttlefish are believed to be abundant and faces no threat of extinction. Studies indicate that fishing is occurring around the maximum sustainable yield, so no special conservation status is applied to them.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • Royer, J., G. Pierce, E. Foucher, J. Robin. 2006. The English Channel stock of Sepia officinalis: Modelling variability in abundance and impact of the fishery. Fisheries Research, 78: 96-106. Accessed December 10, 2010 at http://cat.inist.fr/?aModele=afficheN&cpsidt=17618051.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

This common species is fished commercially, and is also caught in bycatch (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Sepia officinalis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sepia officinalis is commercially fished and eaten by humans. Its ink has many uses including homeopathic medicinal uses and use as dyes and paint. Many people keep cuttlefish as pets. People often give cuttlebones from cuttlefish to their pet birds as dietary supplements and to keep their birds' beaks in good health.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; source of medicine or drug ; research and education

  • Davis, D. 2010. "Cuttlebone and birds - five reasons why cuttlebone is good for pet birds" (On-line). Ezine articles. Accessed December 10, 2010 at http://ezinearticles.com/?Cuttlebone-and-Birds---5-Reasons-Why-Cuttlebone-is-Good-For-Pet-Birds&id=2382724.
  • Unknown, 2007. "Sepia (Cuttlefish ink)" (On-line). Accessed December 10, 2010 at http://www.natural-healing-guide.com/Homeopathy/Sepia.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Cuttlefish

The Common Cuttlefish or European Common Cuttlefish (Sepia officinalis) is one of the largest and best known cuttlefish species. It grows to 49 cm in mantle length (ML) and 4 kg in weight.[1] Animals from subtropical seas are smaller and rarely exceed 30 cm in ML.[2]

The Common Cuttlefish is native to at least the Mediterranean Sea, North Sea, and Baltic Sea, although subspecies have been proposed as far south as South Africa. It lives on sand and mud seabeds to a depth of around 200 m. As in most cuttlefish species, spawning occurs in shallow waters.[3]

Contents

Predators and prey

S. officinalis from Turkish waters

Known predators of S. officinalis include large fish[4] (such as monkfish and swordfish, Xiphias gladius)[5][6] and whales.[4]

In the wild, S. officinalis is known to prey upon a wide variety of animals. These include: bony fishes, copepods, crustaceans (including Astacus leptodactylus, Carcinus sp., Crangon sp., Daphnia sp., Gammarus sp., Mugil sp., Mysis sp., Penaeus sp., Praunus sp., Sphaeroma sp., Squilla sp.), decapod cephalopods, gastropods, lamellibranches, nemerteans, octopods, ostracods, polychaetes, and pteropods.[7]

A 2008 study on S. officinalis[8] revealed that cuttlefish embryos, if visually exposed to a certain species of prey (e.g. crabs), will hunt primarily for that prey in later life. S. officinalis usually prefer shrimp to crabs, but when the embryos were exposed to crabs and the embryos had hatched, the young cuttlefish switched preferences and proceeded to hunt the crabs more often than the shrimp.[9]

Taxonomy

It is unknown where the type specimen of S. officinalis was collected, as the location is given simply as "Oceano". It is deposited in the Linnean Society of London.[10]

Sepia officinalis jurujubai Oliveira, 1940, originally described as a subspecies of the Common Cuttlefish, is a junior synonym of Sepioteuthis sepioidea.[11]

See also

References

As seen when dead, the long prehensile tentacles being withdrawn from the pouches at the side of the head, in which they are carried during life when not actually in use. a, neck; b, lateral fin of the mantle; c, the eight shorter arms; d, the two long prehensile tentacles; e, the eyes
  1. ^ Reid, A., P. Jereb, & C.F.E. Roper 2005. Family Sepiidae. In: P. Jereb & C.F.E. Roper, eds. Cephalopods of the world. An annotated and illustrated catalogue of species known to date. Volume 1. Chambered nautiluses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes. No. 4, Vol. 1. Rome, FAO. pp. 57–152.
  2. ^ Roper C.F.E., M.J. Sweeney & C.E. Nauen 1984. Cephalopods of the world. Food and Agriculture Organization, Rome, Italy. Vol. 3, p. 277.
  3. ^ Norman, M.D. 2000. Cephalopods: A World Guide. ConchBooks.
  4. ^ a b Le-Mao, P. 1985. Place de la seiche Sepia officinalis (mollusque, Cephalopoda) dans les chaines alimentaires du golfe Normano-Breton. Cah. Biol. Mar. 26(3): 331-340.
  5. ^ Hernández-Garcia, V. 1995. The diet of the swordfish Xiphias gladius Linnaeus, 1758, in the central east Atlantic, with emphasis on the role of cephalopods. Fishery Bulletin 93: 403-411.
  6. ^ Royer, J., M.B. Santos, S.K. Cho, G. Stowasser, G.J. Pierce, H.I. Daly & J.-P. Robin. 1998. Cephalopod consumption by fish in English Channel and Scottish waters. International Council for the Exploration of the Sea: The impact of Cephalopods in the Food Chain and Their Interaction with the Environment, CM/M: 23.
  7. ^ Boletzky S.v. & R.T. Hanlon. 1983. A Review of the Laboratory Maintenance, Rearing and Culture of Cephalopod Molluscs. Memoirs of the National Museum of Victoria: Proceedings of the Workshop on the Biology and Resource Potential of Cephalopods, Melbourne, Australia, 9–13 March 1981, Roper, Clyde F.E., C.C. Lu &F.G. Hochberg, ed. 44: 147-187.
  8. ^ Anne-Sophie Darmaillacq, Clemence Lesimple, and Ludovic Dickel. 2008. Embryonic visual learning in the cuttlefish, Sepia officinalis. Animal Behaviour 76: 131–134
  9. ^ Walker, M. 2008. Cuttlefish spot target prey early. BBC News, June 5, 2008.
  10. ^ Current Classification of Recent Cephalopoda
  11. ^ Adam, W. & W.J. Rees. 1966. A Review of the Cephalopod Family Sepiidae. John Murray Expedition 1933-34, Scientific Reports 11(1): 1-165, 46 plates.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!