Overview

Comprehensive Description

Description

 A plump, rounded cuttlefish small in size of up to 6 cm, with rounded fins that do not run along its entire length. The colour varies from black-brown to pale dorsally and pale ventrally. It is rarely striped.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 170 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0 - 157
  Temperature range (°C): 6.911 - 10.582
  Nitrate (umol/L): 1.402 - 11.346
  Salinity (PPS): 33.748 - 35.276
  Oxygen (ml/l): 6.058 - 6.532
  Phosphate (umol/l): 0.321 - 0.858
  Silicate (umol/l): 0.987 - 5.511

Graphical representation

Depth range (m): 0 - 157

Temperature range (°C): 6.911 - 10.582

Nitrate (umol/L): 1.402 - 11.346

Salinity (PPS): 33.748 - 35.276

Oxygen (ml/l): 6.058 - 6.532

Phosphate (umol/l): 0.321 - 0.858

Silicate (umol/l): 0.987 - 5.511
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Often found in rockpools, subtidally and offshore. Swims over or burrows in sand and gravel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sepiola atlantica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTTTCGGTATTTCCCCTGGTCTACTTGGAACTTCATTAAGTTTACTAATCCGAACTGAATTAGGAAAACCTGGTTCATTATTAAATGAT---GATCAACTATACAATGTAGTAGTAACTGCACATGGTTTTATTATAATTTTTTTTTTAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTGTTACCTCCTTCCCTAACTTTACTTTTAGCTTCTTCAGCTGTAGAAAGAGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTTTATCTAGAAATGTGTCTCATGCAGGACCTTCAGTTGACTTAGCTATTTTTTCTCTTCATTTAGCTGGTGTTTCATCAATTTTAGGAGCTATTAACTTTATTACAACTATTATAAATATACGATGAGAAGGTTTACAAATGGAACGATTACCTTTATTTGTATGATCTGTTTTTATTACTGCTATTCTATTATTATTATCTTTACCAGTATTAGCTGGTGCAATTACAATATTACTAACCGATCGAAATTTTAATACAACCTTTTTTGACCCAAGGGGAGGGGGAGATCCTATTTTATATCAACATCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sepiola atlantica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sepiola atlantica

Sepiola atlantica, also known as the Atlantic bobtail, is a species of bobtail squid native to the northeastern Atlantic Ocean (65ºN to 35ºN), from Iceland, the Faroe Islands and western Norway to the Moroccan coast. There is a single record of this species from the Mediterranean Sea.[1]

Both sexes of S. atlantica grow to around 21 mm in mantle length.[1]

The type specimen was collected in the Bay of Biscay and is deposited at the Muséum National d'Histoire Naturelle in Paris.[2]

References

  1. ^ a b Reid, A. & P. Jereb 2005. Family Sepiolidae. In: P. Jereb & C.F.E. Roper, eds. Cephalopods of the world. An annotated and illustrated catalogue of species known to date. Volume 1. Chambered nautiluses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes. No. 4, Vol. 1. Rome, FAO. pp. 153–203.
  2. ^ Current Classification of Recent Cephalopoda

Further reading

  • (French) Adam, W. 1934. Notes sur les céphalopodes. IV. La variation de la radule chez Sepiola atlantica d'Orbigny 1839. Bull. Mus. Roy. Hist. Nat. de Belgique 10(24): 1-4.
  • (French) Boucaud-Camou, E. Les mucopolysaccharides dans le tube digestif de Sepiola atlantica d'Orbigny. Archives De Zoologie Expérimentale et Générale 108(2): 333-346.
  • Duncan, G. & P.B. Pynsent 1979. An analysis of the wave forms of photoreceptor potentials in the retina of the cephalopod Sepiola atlantica. Journal of Physiology 288: 171-188.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!