Overview

Brief Summary

Spisula solidissima, the Atlantic surfclam, is a bivalve of the family Mactridae, and one of the largest and also longest-living Atlantic bivalve species, growing up to over two hundred millimeters in length and generally living past twelve years of age. Its shells are generally roughly trigonal in shape, with concentric striated ridges and a yellowish brown periostracum covering. One of its main morphological defining features is its partially exposed spisuloid ligament. Residing primarily in Northeastern U.S. coastal waters, with high densities off New Jersey and Long Island, it is generally found in turbulent coastal waters, or occasionally deeper areas of the surf zone, where it burrows within small aggregates of other surfclams and filter feeds. Within its ecosystem, Spisula solidissima consumes plankton while serving as a food source for many species of the local marine life. It is also one of the primary species of clam currently consumed in the U.S., and its population is considered safe at present due to fishing regulations.

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 The shell is strong and oval in shape and yellowish white in colour, with a thin yellowish brown periostracum. It can grow up to 22 cm in length. The sculpture of the shell is smooth except for small irregular radiating ridges. The teeth on the hinge line may be serrated particularly in younger shells. When the valves are closed the gape is slight.The subspecies Spisula solidissima simulis is more elongate than the surf clam with a flatter anterior slope.  Surf calms tend to leap out of the sediment when disturbed. In dense beds, the clams compete for space, therefore, localized physical stimulation of the mantle edge from contiguous clams can produce shell regeneration. Subsequently, overall irregularity in shell growth and shape is evident amongst individuals growing in surf clam beds. Spisula solidissima beds occur in even aggregations, localised or patchy dense beds. Prefers areas of turbulent water in water temperatures less than 25C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gulf of St. Lawrence to South Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spisula Solidissima is distributed along the western North Atlantic continental shelf, reaching from the southern Gulf of St Lawrence up to Cape Hatteras in North Carolina. Major concentrations are found on Georges Bank, to the south of Cape Cod, off of Long Island, near southern New Jersey, and around the Delmarva Peninsula (Cargnelli et al., 1999).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

In shape, the shells of Spisula solidissima are anywhere between oval and trigonal. Although they reach a maximum size of 226 mm, Atlantic surfclams are, on average, between 45 and 90 mm in shell length at the age of sexual maturity. The shells are concentrically striated or ridged, with the ridges located very close to one another. When the shell is closed, there is still a visible slight gape between the valves, at the posterior, siphonal end. In color, the shell is yellowish white, with a thin yellowish brown periostracum, or thin organic coating or "skin". Apart from these apparent shell features, the only other external structure which makes this species identifiable to the naked eye is the partially external spisuloid ligament. Other morphological features include a complete complement of lateral teeth, which consist of tiny, saw-tooth ridges, as well as a pallial sinus which is shallow and not larger than adductor muscle scar (Fay et al., 1983).

Because of the wide geographic range of this species along the North American Atlantic coast, there are various localities where this species exhibits slightly different growth patterns (largely due to environmental factors such as temperature, distance from the coast, and particular habitat, i.e. sediment content of habitation site). However, for the most part, growth patterns during the first 3 to 5 years in the life of the Atlantic surfclam are the same amongst the various localities (Fay et al., 1983).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The shell is oval to roughly trigonal in shape, striated, or ridged, with small, concentric growth lines along the surface (Fay et al., 1983). In color, it is yellowish white, with a thin yellowish brown periostracum, or thin organic coating or "skin" on the outermost shell layer. Its lateral teeth consist of tiny, saw-tooth ridges. Its main ligament is partially external, and visible to the naked eye (Huber and Rosenberg, 2011).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Spisula polynyma (Stimpson, 1860) - Compared to Spisula solidissima, Spisula polynyma is darker in color, and has heavy, concentric, wide growth lines on the outer surface of its shell, which is coarser than that of Spisula solidissima. Aside from having a larger palial sinus than Spisula solidissima, Spisula polynyma can also be distinguished by its purple-hued foot, siphon, and mantle edge (Huber and Rosenberg, 2011).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 2 taxa.

Environmental ranges
  Depth range (m): 2.7 - 2.7
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Adults tend to burrow in medium to coarse sand or gravel substrata but are also found in silty to fine sand. This species does not tend to burrow in mud. Found at depths ranging from 8 to 66 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spisula solidissima is most commonly found in turbulent oceanic waters beyond breaker zone, from about 8-66 m, although some are known to have inhabited areas of the surf zone (Cargnelli et al., 1999). Individuals reside in sandy substrates located between the shallow subtidal zone and the aforementioned depths. S. solidissima is generally found in moderately estuarine areas where tidal currents are strong, (Hare et al., 2010) and temperatures below 25 degrees Celsius. Adult individuals tend to burrow in medium to coarse sand or gravel in these areas, but are also found in silty sediments to fine sand (Carter 2005).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

In the larval stage, lasting about 21 days, at which point the larvae metamorphose into juveniles (Fay et al., 1983), dispersal occurs by means of oceanic currents (Cargnelli et al., 1999). And although specific information regarding the exact effects of oceanic currents on larval distribution is unavailable (Hare et al., 2010), a population of surfclams residing off western Long Island is believed to have accumulated there by convergence of tidal and longshore currents during the larval stage (Cargnelli et al., 1999). Water currents in areas where larvae live help to determine their eventual patterns of distribution and settlement. Dispersal of surfclams also occurs through swimming and crawling during larval stages (Hare et al., 2010).

Oceanic warming causes a shift in the range of Spisula solidissima, as has been proven by a recent shift in range to cooler, deeper water off the Delmarva Peninsula (Hare et al., 2010).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding in Atlantic surfclams is intimately associated with their processes of respiration and excretion. The inhalant siphon is used for plankton intake, as Spisula solidissima is a planktivorous siphon-feeder (thus a heterotrophic consumer), like many bivalves. Atlantic surfclams burrow in the substrate so that their inhalant siphon will barely protrude from the bottom, allowing them to filter their plankton from the moving surf (Fay et al., 1983).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Spisula solidissima is as a consumer in its ecosystem and takes the role of consuming the abundant plankton in its area. The surfclam's exact diet and amount of food intake, however, is to some extent dependent upon the surfclam's specific geographic location, as well as seasonal variation in food availability. The Atlantic surfclam is subject to much predation, primarily by two moon snail species, Lunatia heros and Polinices duplicatus (Fay et al., 1983). However, many other Atlantic marine species prey on Spisula solidissima, including brachyuran crabs, hermit crabs, crangonid shrimp, naticid snails, and starfish (Ma et al., 2006).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Spisula solidissima exhibits little or no movement throughout its adult life. Adults rarely vacate their burrows, and may live their entire adult lives within a single burrow under natural conditions and stimuli. Juvenile surfclams, on the other hand, do exhibit some limited motion in the form of "leaping", i.e. using the foot to push against the substrate. This usually occurs in response to a disturbance or predator, and usually results in the juvenile returning to the same spot which it leapt out of (Fay et al., 1983).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Atlantic surfclams reach a maximum age of 31 years (Cargnelli et al., 1999). Demographically, average longevity can be represented as follows: in offshore Virginia, between 1 and 19 years of age; inshore Chincoteague Inlet, Virginia, between 1 and 3 years of age; offshore Ocean City, Maryland, between 1 and 13 years of age; inshore Barnegat Bay, New Jersey, between 1 and 6 years of age; inshore Point Pleasant, New Jersey, between 1 and 11 years of age; offshore Point Pleasant, New Jersey, between 1 and 25 years of age; offshore central New Jersey, between 1 and 12 years of age; and offshore Long Island, New York, between 1 and 17 years of age. This data supports the hypothesis that taxa living in offshore, deepwater clam beds generally live longer than those from inshore, shallow water beds. This may not be purely ecological, but may also be attributed to the exploitation and use of surfclams in shallower beds (Fay et al., 1983). For more information, see "Uses" section.

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawning occurs annually during the summertime for Atlantic surfclams. In New Jersey coastal waters, spawning was observed between mid-July and August (Fay et al., 1983), but observations taken further south (around Virginia and North Carolina) showed earlier dates of spawning, beginning between April and May and going through June (Cargnelli et al., 1999). Male and female surfclams both reach sexual maturity around the age of two, although in some cases ripe gonads and spawning are observed at the age of one. Eggs and sperm are broadcast by each respective sex and fertilization occurs in the water column above the clams' spawning bed (Fay et al., 1983).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Recent studies have been made concerning the relationship of Spisula solidissima and its most closely related sister taxon, Spisula solidissima similis. These studies have shown that, in addition to the fact that S. solidissima and S. s. similis are indeed genetically different, a genetically different subspecies has come to exist within S. s. similis. A genetic modification has occurred between the population of this species on the Atlantic coast and that which resides in the Gulf of Mexico (Hare et al. 2010), perhaps suggesting the emergence of a newly recognized taxa in the years to come.

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Functional Adaptations

Functional adaptation

Gills reduce drag: Atlantic surf clam
 

The abfrontal surface of Atlantic surf clam gills may reduce frictional drag using lubricating mucus.

       
  "Mucus in molluscs serves many purposes, one of which is lubrication (Prezant 1985; Simkiss 1988; Davies and Hawkins 1998). In the context of bivalve gills, the secretion of mucus on the abfrontal surface might be adaptive if it reduces friction between water and the epithelium, in a manner similar to the drag reduction produced by fish epithelial mucus (Hoyt 1975; Daniel 1981). Abfrontal surface lubrication could be of particular importance in eulamellibranchs because water pumped through their gills is directed into abfrontal chambers of reduced volume, where frictional drag between water and the epithelium is probably important (Beninger et al. 1997a).

"In the species studied, abfrontal mucocyte density was greatest in the eulamellibranch Spisula solidissimaThe presence of residual mucus shows that AMPS are secreted on the abfrontal surface of the gills of these eulamellibranchs. Acidic mucus is highly viscous and is a good lubricant because it is not easily hydrated or removed from the epithelium (Hunt 1970; Faillard and Schauer 1972).

"It is therefore possible that mucus on the abfrontal surface of eulamellibranch gills is important in lubrication." (Dufour and Beninger 2001:303-305)

  Learn more about this functional adaptation.
  • Dufour SC; Beninger PG. 2001. A functional interpretation of cilia and mucocyte distributions on the abfrontal surface of bivalve gills. Marine Biology. 138(2): 295-309.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

There are 17 barcode sequences available for Spisula solidissima, available for further viewing here, along with 19 concurrent records for partial sequences of nuclear and mitochondral genes.

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Spisula solidissima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGATATTGGAACTTTGTATTTTGTGTTTTCTTATTGGGCCGGTATGGCGGGGACGGGGTTTAGGATAATTATCCGAATGGAGCTTGGCATGCCAGGCGAAATAATACTAGAT---GGTCAAACCTATAATGTGGTTGTGACGGCGCATGCTTTAATTATGATTTTTTTCTTGGTTATACCCATGATAATGGGGGGATTTGGTAATTGGTTAGTTCCTTTAATACTAAAGATTCCTGACATAAGTTTTCCTCGGATGAATAATGTTAGGTTTTGGCTTCTTCCTGTTTCTCTTCTTCTGTTGGTGGCTTCGGTTTTTTCTGAGGGTGGTCCAGGTACTGGGTGGACTATTTATCCGCCCCTATCTAGGTTTATAGGGCATCCTGGGCCAGCAGTGGATTACGCTATCTTGTCTCTTCACGTTGGTGGTGTTTCTTCTATTTTAGCTTCACTTAATTTTCTTACTACTTTTCTTTCTATACGACTGAAAATTATAACGTTGTATCGCACTCCTATGTTTGTGTGGTGTATGGGCGTCACTAGGTTTCTTCTAGTTGTTGCAATGCCTTTTTTGGCTGGGGCGTTGACTATACTTTTAACTGATCGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spisula solidissima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Common marine species (Abbott, 1968).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little to no active conservation efforts are currently in place on behalf of the Atlantic surfclam. As the U.S.'s primary source of clam meat, Atlantic surfclams suffered from severe overfishing between 1974 and 1976. However, since fishing regulations on Spisula solidissima passed in 1976, surfclam populations have remained stable and safe. They are no longer the primary source of U.S. consumed clam meat and, although still commercially exploited, do not have their population sizes significantly threatened (Fay et al., 1983). For further information on clam fishing, see the section on "Uses".

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Although the surfclam industry began simply as small bait fisheries before World War II, it has become the leading source of clam meat consumed in the United States. Between 1970 and 1974, the Atlantic surfclam provided 71.8% of clam meat consumed in the U.S. (Fay et al., 1983). Although the amount of meat acquired between 1974 and 1976 decreased due to overfishing, a quota system established in 1977 allowed for closer regulation of surfclam catching, and now the industry is back on track, with the industry having successfully obtained 31,000 tons of clam meat in 1994 without seriously harming the abundant population. Atlantic surfclam are caught today primarily through the use of hydraulic clam dredges (Weinberg 1993).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Atlantic surf clam

The Atlantic surf clam, also referred to as the "bar clam," "hen clam," "skimmer," or simply as the "sea clam,"[1] is a western Atlantic surf clam, a very large (20 cm), edible, saltwater clam or marine bivalve mollusk in the family Mactridae. It is a much larger relative of the eastern Atlantic surf clam.

The shell of this species is a well-known object to beach-goers in the northeastern United States. People on the beach often pick up a large empty shell of this species, either to dig in the sand with, or take home to use as a decorative dish or ashtray.

The species is exploited commercially as a food item.

An 8 cm juvenile valve of Spisula solidissima

Distribution[edit]

This common species occurs off the east coast of North America from Nova Scotia to South Carolina.[2]

It has also been introduced and farmed in Hokkaidō, northern Japan.[citation needed]

Habitat[edit]

Atlantic surf clams lived buried in coarse or fine sand. They live offshore as well as in the low intertidal and surf zones.

Life habits[edit]

Surf clams that live along the New Jersey coast are believed to grow to maturity in approximately seven years, far less than previously thought, according to Rutgers research at the Haskin Shellfish Research Laboratory, in Bivalve, New Jersey[citation needed].

These clams use their siphons to pull in and then filter fine particles of organic matter and plankton from the surrounding seawater, in other words, like almost all clams, they are filter feeders.

Human use[edit]

This species is a commercially exploited species, long prized for its sweet flavor. About two-thirds of a surf clam's shucked weight is viable for human consumption.[3] The meat of the clam is used as 'strips', chowder, and sushi.

The "tongue" or foot of the clam is commercially valuable because it is cut into long strips which are breaded and fried and served as "clam strips", first popularized by the Howard Johnson's franchise.

The meat that is left over is separated from the "belly" and is referred to as "salvage" within the clam industry. This meat includes the adductor muscles, which are the strong muscles that close the two halves of the shell and which tightly hold the clam's shell in the shut position. "Salvage" is typically ground up for use in chowders, sauces, and dips, and is commercially available either in cans or frozen. Locally it is available fresh.

As a side note, the substantial "belly" of the clam is used by knowledgeable fishermen as excellent bait for striped bass and other species.

References[edit]

  1. ^ Director Dan Horn, "Sea Clam," http://www.town.barnstable.ma.us/NaturalResources/GuideToShellfishing/seaclam.asp, accessed September 15, 2009.
  2. ^ Rehder, H.A. (1981). The Audubon Society Field Guide to Seashells of North America. New York: Alfred A. Knopf. ISBN 0-394-51913-2. 
  3. ^ Virginia Marine Products Board, "Atlantic Surf Clam," http://www.virginiaseafood.org/consumers/factsheets/atlanticsurfclam.htm, accessed September 15, 2009.
  • The Long Island Shell Club, 1988. Seashells of Long Island, Long Island Shell Club Inc, New York State.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!