Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Theria rupicapraria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Theria rupicapraria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGCTCACTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTGCCCCCCTCCATTACTTTATTAATTTCTAGAAGAATTGTAGAAAGTGGGGCAGGAACTGGATGAACAGTTTATCCACCTTTGTCATCTAATATTGCACATGGGGGAAGATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCGGGTATTTCTTCAATTTTAGGGGCAATTAATTTCATTACTACAATTATTAATATACGATTAAACAATATATCATTTGATCAAATACCATTATTTGTGTGAGCTGTAGGAATTACTGCATTTTTATTATTATTATCATTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACCGATCGAAACTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Theria rupicapraria

Theria primaria is a moth of the Geometridae family. It is found throughout in Europe and the South Caucasus.

The wingspan is 28–30 mm for males. Females have reduced wings. Adults are on wing from January to April. There is one generation per year.

The larva feed on Crataegus and Prunus spinosa. Larvae can be found in June. It overwinters as a pupa.

Subspecies[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!