Overview

Comprehensive Description

Mastodons are part of the order Proboscidea, which also includes mammoths and other elephants. Species in this order can be immense in size, and the larger species have massive column-like limbs, a long and flexible trunk, and well-developed tusks.

Mastodons lived from the early Miocene to the Holocene (about 23 million to ~ 10,000 years ago). Mastodons preferred to live in spruce woodlands and forests but were also found to live in valleys, lowlands, and swamps.

Mammut americanum was an herbivore, which means it only ate plants. Mammut americanum mostly ate coniferous trees. They would eat twigs, cones, leaves, and pine needles.

Between 9,000 and 12,000 years ago mastodons went extinct.

The term Mammut comes from European farmers from the Middle Ages and means “earth burrower”. The farmers found the massive bones in their fields and thought they belonged to monstrous burrowing beasts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mastodons were found throughout Africa, Asia and Europe from the Oligocene to the early Pleistocene (about 27 million to 1.8 million years ago). They were also found in North America from the middle Miocene to the early Holocene (about 13 million to ~10,000 years ago).

Mammut americanum was a dominant and widespread animal in North America during the Pleistocene (about 1.8 million to ~10,000 years ago). They ranged from Alaska to Florida and were most abundant in eastern forests. In fact, many Mammut americanum teeth were found in Northeastern conifer-forests that were 300km from the present shoreline. During the last 25,000 years many Mammut americanum lived on conifer-covered land that is now below the sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Mastodons are part of the order Proboscidea, which also includes mammoths and other elephants. Species in this order can be immense in size, and the larger species have massive column-like limbs, a long and flexible trunk, and well-developed tusks.

The molars of Mammut americanum were very different from the molars of modern elephants. Mammut americanum molars had pairs of cone-like ridges with open valleys that looked like miniature mountain ranges. Mammut americanum had six molars on each half of their jaw. Worn molars would fall out at the front of the jaw, and new molars would form in the back and move forward to replace worn teeth. They often had more than one tooth in each half-jaw at a time. These teeth were used to grind vegetation, like a mortar-and-pestle.

The skull of Mammut americanum was longer than a mammoth’s skull. Its skull was carried horizontally, had a flattened forehead, and a long rounded lower jawbone, sometimes with a pair of short lower tusks. Both males and females had tusks in their upper jaws, but males had larger and heavier tusks. Young males would also have small under-developed lower tusks, but they usually lost these tusks with maturity. The upper tusks extended 2 to 3 meters below the nasal bones, and were horizontal to the skull. The tusks were modified incisors. A cross-section of a tusk showed that it grew in a cone pattern (like a stack of ice cream cones) and traces of annual growth rings were also found. Usually one tusk would be shorter than the other, meaning that a mastodon would use one tusk more than the other.

Since mastodons are early cousins of modern elephants, their body shapes and sizes are similar. However mastodons had deeper chests, broader hips, shorter legs, and a longer back than modern elephants. They were covered in coarse brownish hair about 2.75m long, and they probably did not have a wooly undercoat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Mammut americanum could range from 2.7m to 3.0m in height from foot to shoulder, be about 4.5m long, and would weight between 3,600 – 5,500 kg. Females were smaller than the males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mastodons lived from the Oligocene to the Holocene (at least 27 million to ~ 10,000 years ago). The earliest mastodon that scientists are certain of is Losodokodon losodokius from Lothidok, Kenya. Mastodons preferred to live in spruce woodlands and forests, but were also found to live in valleys, lowlands, and swamps.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

They lived in Eastern North America 2 to 10,000 million years ago were they thrived in forest and opened meadows.

  • Darcae Holmes, Aaryn Flinkea, Mammut Americanum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Darcae Holmes

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mammut americanum was an herbivore, which means it only ate plants. Mammut americanum mostly ate coniferous trees. They would eat twigs, cones, leaves, and needles. They would use their tusks to break off branches into smaller pieces, and their molars to shear and grind the pieces. They have also been found to eat other coarse vegetation such as swamp plants, mosses, grape leaves, and coarse grasses. In contrast to mammoths, which were primarily grazers (ate grasses and low-growing vegetation), mastodons were primarily browsers (ate twigs, leaves and high-growing vegetation).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Between 9,000 and 12,000 years ago mastodons went extinct. Approximately 10,000 years ago the globe started to warm up, the last ice age ended, and mastodons lost many of their habitats and sources of food. However, many scientists think that the climate shift was not enough to cause the extinction of mastodons. 10,000 years ago, humans were found in most areas of the globe and hunted mastodons. It is thought that increased hunting pressure from humans combined with the change in climate caused the extinction of mastodons. However, scientists are still debating and researching this theory.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Mastodons had few predators because of their large size but there is evidence that humans hunted them. A Clovis arrowhead was found with the bones of Mammut americanum, which suggests that humans hunted them for food from at least 12,000 years ago. Lions occasionally kill young or sick adult elephants in Africa today, and the North American lions (Panthera atrox) were larger than modern lions so they may have also occasionally killed mastodons.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Since Mammut americanum is a distant cousin to modern elephants it is difficult to know what their behavior was like. Elephants are highly social animals, and there is some evidence that mastodons were also social. Male mastodons had larger bodies and tusks than females. It is thought that the larger size of the males helped them to compete for females. Mastodons took about 10 years to fully mature so a logical guess would be that mastodons took care of their young much like modern elephants do. Many mastodon findings are of single individuals which suggests that mastodons did not live in herds like modern elephants or it could be evidence of male mastodons traveling without the herd like modern elephants do. Scientists are debating and researching the complex issue of mastodon behavior.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Mammut americanum belongs to the Mammutidae family and there are about 15 different species of mastodon. Mastodons are a much older taxon than mammoths or elephants. Mastodons share a common ancestor with mammoths and elephants but evolved millions of years before mammoths and elephants. For example, the earliest mastodon is at least 27 million years old; the oldest known elephants are likely not older than 9 million years; the oldest mammoth is from Africa and dates to about 6-5 million years. As mastodons evolved they became much larger (from rhino-sized to elephant-sized) and their teeth became broader.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mammut americanum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGGCTGTATTCAACAAATCACAAAGATATTGGAACACTATACTTGCTATTTGGTGCCTGAGCTGGTATAGTAGGAACTGCTTTTAGTATCCTAATTCGGGCAGAACTAGGTCAACCAGGCTCCCTTCTTGGAGAT---GATCAGATCTATAATGTTATTGTTACAGCACACGCCTTTGTAATAATCTTCTTCATAGTCATGCCAATTATAATTGGGGGCTTCGGAAATTGGTTAATTCCACTTATAATCGGAGCACCCGATATAGCTTTCCCTCGAATAAATAACATAAGTTTTTGACTACTGCCCCCATCTTTCCTACTGCTTTTAGCATCTTCTACAGTAGAAGCTGGAGCAGGTACTGGATGAACCGTATACCCTCCCCTAGCAGGGAATCTAGCCCACGCAGGGGCTTCCGTAGATTTAACGATCTTTTCACTCCACCTTGCAGGAGTATCCTCCATTCTAAGTGCAATCAATTTCATCACCACTATCATTAACATGAAACCCCCAGCCATATCTCAATACCATATGCCTTTATTTGTGTGGTCCATTTTAGTAACAGCTGTCCTTCTTCTCCTGTCTCTCCCAGTTCTAGCGGCAGGTATTACTATATTATTAACGGACCGCAATCTTAATACTACTTTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTATACCAACATCTGTTCTGATTTTTTGGACACCCTGAAGTCTATATTCTGATTCTCCCAGGATTTGGAATAGTCTCTCATATTGTTACATACTATTCAGGGAAAAAAGAACCTTTCGGTTATATAGGAATGGTATGAGCCATAATATCCATTGGCTTCCTAGGGTTTATTGTATGAGCTCACCATATATTCACTGTAGGCATAGATGTTGACACCCGAGCTTACTTCACATCAGCTACTATAATCATTGCTATTCCAACTGGAGTGAAAGTCTTCAGCTGACTAGCCACTCTCCACGGTGGT---GAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mammut americanum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!