Overview

Comprehensive Description

Comprehensive Description

Mastodons are part of the order Proboscidea, which also includes mammoths and other elephants. Species in this order can be immense in size, and the larger species have massive column-like limbs, a long and flexible trunk, and well-developed tusks.

Mastodons lived from the early Miocene to the Holocene (about 23 million to ~ 10,000 years ago). Mastodons preferred to live in spruce woodlands and forests but were also found to live in valleys, lowlands, and swamps.

Mammut americanum was an herbivore, which means it only ate plants. Mammut americanum mostly ate coniferous trees. They would eat twigs, cones, leaves, and pine needles.

Between 9,000 and 12,000 years ago mastodons went extinct.

The term Mammut comes from European farmers from the Middle Ages and means “earth burrower”. The farmers found the massive bones in their fields and thought they belonged to monstrous burrowing beasts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Mastodons were found throughout Africa, Asia and Europe from the Oligocene to the early Pleistocene (about 27 million to 1.8 million years ago). They were also found in North America from the middle Miocene to the early Holocene (about 13 million to ~10,000 years ago).

Mammut americanum was a dominant and widespread animal in North America during the Pleistocene (about 1.8 million to ~10,000 years ago). They ranged from Alaska to Florida and were most abundant in eastern forests. In fact, many Mammut americanum teeth were found in Northeastern conifer-forests that were 300km from the present shoreline. During the last 25,000 years many Mammut americanum lived on conifer-covered land that is now below the sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Morphology

Mastodons are part of the order Proboscidea, which also includes mammoths and other elephants. Species in this order can be immense in size, and the larger species have massive column-like limbs, a long and flexible trunk, and well-developed tusks.

The molars of Mammut americanum were very different from the molars of modern elephants. Mammut americanum molars had pairs of cone-like ridges with open valleys that looked like miniature mountain ranges. Mammut americanum had six molars on each half of their jaw. Worn molars would fall out at the front of the jaw, and new molars would form in the back and move forward to replace worn teeth. They often had more than one tooth in each half-jaw at a time. These teeth were used to grind vegetation, like a mortar-and-pestle.

The skull of Mammut americanum was longer than a mammoth’s skull. Its skull was carried horizontally, had a flattened forehead, and a long rounded lower jawbone, sometimes with a pair of short lower tusks. Both males and females had tusks in their upper jaws, but males had larger and heavier tusks. Young males would also have small under-developed lower tusks, but they usually lost these tusks with maturity. The upper tusks extended 2 to 3 meters below the nasal bones, and were horizontal to the skull. The tusks were modified incisors. A cross-section of a tusk showed that it grew in a cone pattern (like a stack of ice cream cones) and traces of annual growth rings were also found. Usually one tusk would be shorter than the other, meaning that a mastodon would use one tusk more than the other.

Since mastodons are early cousins of modern elephants, their body shapes and sizes are similar. However mastodons had deeper chests, broader hips, shorter legs, and a longer back than modern elephants. They were covered in coarse brownish hair about 2.75m long, and they probably did not have a wooly undercoat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Mammut americanum could range from 2.7m to 3.0m in height from foot to shoulder, be about 4.5m long, and would weight between 3,600 – 5,500 kg. Females were smaller than the males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Mastodons lived from the Oligocene to the Holocene (at least 27 million to ~ 10,000 years ago). The earliest mastodon that scientists are certain of is Losodokodon losodokius from Lothidok, Kenya. Mastodons preferred to live in spruce woodlands and forests, but were also found to live in valleys, lowlands, and swamps.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They lived in Eastern North America 2 to 10,000 million years ago were they thrived in forest and opened meadows.
  • Darcae Holmes, Aaryn Flinkea, Mammut Americanum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Darcae Holmes

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Trophic Strategy

Mammut americanum was an herbivore, which means it only ate plants. Mammut americanum mostly ate coniferous trees. They would eat twigs, cones, leaves, and needles. They would use their tusks to break off branches into smaller pieces, and their molars to shear and grind the pieces. They have also been found to eat other coarse vegetation such as swamp plants, mosses, grape leaves, and coarse grasses. In contrast to mammoths, which were primarily grazers (ate grasses and low-growing vegetation), mastodons were primarily browsers (ate twigs, leaves and high-growing vegetation).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Between 9,000 and 12,000 years ago mastodons went extinct. Approximately 10,000 years ago the globe started to warm up, the last ice age ended, and mastodons lost many of their habitats and sources of food. However, many scientists think that the climate shift was not enough to cause the extinction of mastodons. 10,000 years ago, humans were found in most areas of the globe and hunted mastodons. It is thought that increased hunting pressure from humans combined with the change in climate caused the extinction of mastodons. However, scientists are still debating and researching this theory.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predators

Mastodons had few predators because of their large size but there is evidence that humans hunted them. A Clovis arrowhead was found with the bones of Mammut americanum, which suggests that humans hunted them for food from at least 12,000 years ago. Lions occasionally kill young or sick adult elephants in Africa today, and the North American lions (Panthera atrox) were larger than modern lions so they may have also occasionally killed mastodons.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Since Mammut americanum is a distant cousin to modern elephants it is difficult to know what their behavior was like. Elephants are highly social animals, and there is some evidence that mastodons were also social. Male mastodons had larger bodies and tusks than females. It is thought that the larger size of the males helped them to compete for females. Mastodons took about 10 years to fully mature so a logical guess would be that mastodons took care of their young much like modern elephants do. Many mastodon findings are of single individuals which suggests that mastodons did not live in herds like modern elephants or it could be evidence of male mastodons traveling without the herd like modern elephants do. Scientists are debating and researching the complex issue of mastodon behavior.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Mammut americanum belongs to the Mammutidae family and there are about 15 different species of mastodon. Mastodons are a much older taxon than mammoths or elephants. Mastodons share a common ancestor with mammoths and elephants but evolved millions of years before mammoths and elephants. For example, the earliest mastodon is at least 27 million years old; the oldest known elephants are likely not older than 9 million years; the oldest mammoth is from Africa and dates to about 6-5 million years. As mastodons evolved they became much larger (from rhino-sized to elephant-sized) and their teeth became broader.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mammut americanum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA803-07|NC_009574|Mammut americanum| AACCGCTGGCTGTATTCAACAAATCACAAAGATATTGGAACACTATACTTGCTATTTGGTGCCTGAGCTGGTATAGTAGGAACTGCTTTT---AGTATCCTAATTCGGGCAGAACTAGGTCAACCAGGCTCCCTTCTTGGAGAT---GATCAGATCTATAATGTTATTGTTACAGCACACGCCTTTGTAATAATCTTCTTCATAGTCATGCCAATTATAATTGGGGGCTTCGGAAATTGGTTAATTCCACTTATA---ATCGGAGCACCCGATATAGCTTTCCCTCGAATAAATAACATAAGTTTTTGACTACTGCCCCCATCTTTCCTACTGCTTTTAGCATCTTCTACAGTAGAAGCTGGAGCAGGTACTGGATGAACCGTATACCCTCCCCTAGCAGGGAATCTAGCCCACGCAGGGGCTTCCGTAGATTTA---ACGATCTTTTCACTCCACCTTGCAGGAGTATCCTCCATTCTAAGTGCAATCAATTTCATCACCACTATCATTAACATGAAACCCCCAGCCATATCTCAATACCATATGCCTTTATTTGTGTGGTCCATTTTAGTAACAGCTGTCCTTCTTCTCCTGTCTCTCCCAGTTCTAGCGGCA---GGTATTACTATATTATTAACGGACCGCAATCTTAATACTACTTTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTATACCAACATCTGTTCTGATTTTTTGGACACCCTGAAGTCTATATTCTGATTCTCCCAGGATTTGGAATAGTCTCTCATATTGTTACATACTATTCAGGGAAAAAA---GAACCTTTCGGTTATATAGGAATGGTATGAGCCATAATATCCATTGGCTTCCTAGGGTTTATTGTATGAGCTCACCATATATTCACTGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mammut americanum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American mastodon

American mastodon!<-- This template has to be "warmed up" before it can be used, for some reason -->

Animalia

The American mastodon (Mammut americanum) is an extinct North American proboscidean that lived from about 3.7 million years ago until about 10,000 years B.C. It was the last surviving member of the mastodon family. It is known from fossils found ranging from present-day Alaska and New England in the north, to Florida, southern California, and as far south as Honduras[1] and El Salvador. Its main habitat was cold spruce woodlands, and it is believed to have browsed in herds.[2]

Contents

Appearance

The American mastodon resembled a woolly mammoth (Mammuthus primigenius) in appearance, with a thick coat of shaggy hair.[3] A few skeletons have been found with the fur still attached; examination of the hair suggests that mastodons lacked the undercoat characteristic of mammoths.[4] It was about 3 metres (9.8 ft) in height at the shoulder, also similar to woolly mammoths.

However, there are number of significant skeletal differences between mastodons and mammoths. Mastodons' teeth differ dramatically from those of members of the elephant family; they had blunt, conical, nipple-like projections on the crowns of their molars,[5] which were more suited to chewing leaves than the high-crowned teeth mammoths used for grazing; the name mastodon (or mastodont) means "nipple teeth" and is also an obsolete name for their genus.[6] Their skulls are larger and flatter than those of mammoths, while their skeleton is stockier and more robust.[4]

Tusks

Life restoration of Mammut americanum.

The tusks of the American mastodon sometimes exceeded five meters in length; they curved upwards, but less dramatically than those of the woolly mammoth.[4] Young males had vestigial lower tusks that were lost in adulthood.[4] However, it has been proven that female mastodons had lower pairs of tusks. The tusks were probably used to break branches and twigs, although some evidence suggests males may have used them in mating challenges; one tusk is often shorter than the other, suggesting that, like humans and modern elephants, mastodons may have had laterality.[4] Examination of fossilized tusks revealed a series of regularly spaced shallow pits on the underside of the tusks. Microscopic examination showed damage to the dentin under the pits. It is theorized that the damage was caused when the males were fighting over mating rights. The curved shape of the tusks would have forced them downward with each blow, causing damage to the newly forming ivory at the base of the tusk. The regularity of the damage in the growth patterns of the tusks indicates that this was an annual occurrence, probably occurring during the spring and early summer.[7]

Distribution

Mammut americanum life restoration - note that tusk curvature may be excessive

Though their habitat spanned a large territory, American mastodons were most common in the ice age spruce forests of the eastern United States, as well as in warmer lowland environments.[8] Their remains have been found as far as 186 miles (300 kilometers) offshore of the northeastern United States, in areas that were dry land during the low sea level stand of the last ice age.[9] Mastodon fossils have been found on the Olympic Peninsula of Washington, USA (Manis Mastodon Site),[10] in Kentucky (particularly noteworthy are early finds in what is now Big Bone Lick State Park); the floodplain of the East Branch of the DuPage River, near Glen Ellyn, Illinois;[11] the Kimmswick Bone Bed in Missouri; in Stewiacke, Nova Scotia, Canada; at a number of sites in New York State;[12] in Richland County, Wisconsin (Boaz mastodon); La Grange, Texas; Southern Louisiana; north of Fort Wayne, Indiana; Savannah, Georgia; and Johnstown, Ohio[13] USA.

Extinction

Mammut americanum is generally reported as having disappeared from North America about 10,000 years ago,[14] as part of a mass extinction of the Pleistocene megafauna. However more recent radiocarbon dates have been found, such as 5200 B.C. in Seneca, Michigan,[15] 5140 B.C. in Utah,[16] 4150 B.C. in Washtenaw, Michigan,[17] 4080 B.C. in Lapeer, Michigan.[18]

Recent studies indicate that tuberculosis was common in late Pleistocene American mastodons, and it has been suggested that this could have contributed to their extinction 10,000 years ago.[19] However, it is not considered plausible that the disease could have caused the extinction on its own.[19]

Another factor contributing to their eventual extinction in America during the late Pleistocene may have been the presence of Paleo-Indians, who entered the American continent and expanded to relatively large numbers 13,000 years ago.[20] Their hunting caused a gradual attrition of the mastodon and mammoth populations, significant enough that over time the mastodons may have been hunted to extinction.[21][22] Analysis of tusks of mastodons from the American Great Lakes region over a span of several thousand years prior to their extinction in the area shows a trend of declining age at maturation; this is contrary to what one would expect if they were experiencing stresses from an unfavorable environment, but is consistent with a reduction in intraspecific competition that would result from a population being reduced by human hunting.[22]

In September 2007, Mark Holley, an underwater archaeologist with the Grand Traverse Bay Underwater Preserve Council who teaches at Northwestern Michigan College in Traverse City, Michigan, said that they might have discovered a boulder (3.5 to 4 feet (1.2 m) high x 5 feet (1.5 m) long) with a prehistoric carving in the Grand Traverse Bay of Lake Michigan. The granite rock has markings that resemble a mastodon with a spear in its side. Confirmation that the markings are an ancient petroglyph will require more evidence.[23]

Taxonomy

Mammut americanum is a species of the extinct family Mammutidae, related to the proboscidean family Elephantidae (mammoths and elephants). The common name 'Mastodon' derives from a genus named to describe various extinct members of proboscideans, Mastodon (Cuvier) is not currently used. The assignment of the taxon to Mammut, a name that preceded Cuvier's description, met with resistance and authors sometimes applied "Mastodon americanus" as an informal name. Common names for the species have sometimes been "ludicrous and misleading ... The Great American Incognitum. The Leviathan Missourium, The Carnivorous Elephant, Ohio Incognitum, Elephas americanus, a Behemoth, The Pseudelephant, Le Grande Mastodonte, Mastodon giganteus and many others".[24]

In Other Media

The American mastodon is a playable fighter in game Fossil Fighters. The American mastodon is also an animal in Zoo Tycoon 2: Extinct Animals. The band Mastodon take their name from the animal.

Gallery

Mastodon mother and child in the George C. Page Museum at the La Brea Tar Pits, Los Angeles
Warren Mastodon skeleton

See also

References

  1. ^ Polaco, O. J.; Arroyo-Cabrales, J.; Corona-M., E.; López-Oliva, J. G. (2001). "The American Mastodon Mammut americanum in Mexico". In Cavarretta, G.; Gioia, P.; Mussi, M. et al.. The World of Elephants – Proceedings of the 1st International Congress, Rome October 16-20 2001. Rome: Consiglio Nazionale delle Ricerche. pp. 237–242. ISBN 88-8080-025-6. http://www.sovraintendenzaroma.it/content/download/4787/62368/.../237_242.pdf. Retrieved 2008-07-25. 
  2. ^ Palmer, D., ed (1999). The Marshall Illustrated Encyclopedia of Dinosaurs and Prehistoric Animals. London: Marshall Editions. p. 243. ISBN 1-84028-152-9. 
  3. ^ Palmer, D., ed (1999). The Marshall Illustrated Encyclopedia of Dinosaurs and Prehistoric Animals. London: Marshall Editions. pp. 124. ISBN 1-84028-152-9. 
  4. ^ a b c d e Kurtén and Anderson, p. 345
  5. ^ Mastodons
  6. ^ Agusti, Jordi and Mauricio Anton (2002). Mammoths, Sabretooths, and Hominids. New York: Columbia University Press. pp. 106. ISBN 0-231-11640-3. 
  7. ^ Fisher, D. (Oct. 18-21, 2006). "Tusk cementum defects record musth battles in American mastodons". Sixty-Sixth Annual Meeting of the Society of Vertebrate Paleontology. 
  8. ^ Kurtén, Björn and Elaine Anderson. Pleistocene Mammals of North America. New York: Columbia University Press, 1980, p. 344.
  9. ^ Kurtén and Anderson, p. 344.
  10. ^ Kirk, Ruth and Richard D. Daugherty. Archaeology in Washington. Seattle: University of Washington Press, 2007.
  11. ^ http://www.wheaton.edu/Perry/start/start.html
  12. ^ Allmon, Warren D. and Peter L. Nester, editors. Mastodon Paleobiology, Taphonomy, and Paleoenvironment in the Late Pleistocene of New York State: Studies on the Hyde Park, Chemung, and North Java Sites. Ithaca, N.Y.: Paleontological Research Institution, 2008.
  13. ^ http://www.villageofjohnstown.org/history.html
  14. ^ "Greek mastodon find 'spectacular'". BBC News. 24 July 2007. http://news.bbc.co.uk/2/hi/europe/6913366.stm. Retrieved 2007-07-24. 
  15. ^ Richard E. Morlan, Bruggeman Mastodon, Canadian Archaeological Radiocarbon Database, www.canadianarchaeology.ca/localc14/c14search.htm, (Hull Quebec: Canadian Museum of Civilization), retrieved online October 2008.
  16. ^ Wade E. Miller, “Mammut Americanum: Utah’s First Record of the American Mastodon”, Journal of Paleontology, Volume 61, Number 1, (The Paleontological Society, 1987), 168-183.
  17. ^ Margaret Ann Skeels, “The Mastodons and Mammoths of Michigan”, Michigan Academician, Volume XXXIV, Number 3, (Ann Arbor: Michigan Academy of Science, 2002), 254.
  18. ^ H. R. Crane and James B. Griffin, Russell Farm, “University of Michigan Radiocarbon Dates IV”, Radiocarbon, Volume 1, Number 1, (New Haven: Yale, 1959), 178.
  19. ^ a b Mastodons Driven to Extinction by Tuberculosis, Fossils Suggest
  20. ^ Beck, Roger B.; Linda Black, Larry S. Krieger, Phillip C. Naylor, Dahia Ibo Shabaka, (1999). World History: Patterns of Interaction. Evanston, IL: McDougal Littell. ISBN 0-395-87274-X. 
  21. ^ Ward, Peter (1997). The Call of Distant Mammoths. Springer. pp. 241. ISBN 978-0387985725. http://books.google.com/?id=E-JRXiFbcwkC&printsec=frontcover. 
  22. ^ a b Fisher, Daniel C. (2009). "Paleobiology and Extinction of Proboscideans in the Great Lakes Region of North America". In Haynes, Gary. American Megafaunal Extinctions at the End of the Pleistocene. Springer. pp. 55–75. doi:10.1007/978-1-4020-8793-6_4. ISBN 978-1-4020-8792-9. http://www.springerlink.com/content/m39544m241500322/fulltext.pdf. 
  23. ^ Flesher, John (2007-09-04). "Possible mastodon carving found on rock". Associated Press. Archived from the original on 2007-09-04. http://web.archive.org/web/20070904232125/http://news.yahoo.com/s/ap/20070904/ap_on_sc/mastodon_carving. Retrieved 2007-09-05. 
  24. ^ Naming the American Mastodon (reprint). New Jersey State Museum 1960
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!