Ecology

Habitat

They lived in Grassland areas in Europe, Siberia, and North America.

  • Darcae Holmes, Aaryn Flinkea, Mammuthus, primigenius, Habitat
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Darcae Holmes

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mammuthus primigenius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mammuthus primigenius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Mammuthus primigenius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTTGCTAACCGCTGACTATATTCAACAAACCACAAAGACATTGGGACACTGTATCTATTATTTGGTGCTTGAGCTGGTATAGTAGGGACTGCTTTTAGTATCCTAATTCGGGCAGAACTAGGTCAACCAGGCTCTCTTCTTGGAGACGACCAAATCTATAATGTTATTGTCACAGCACACGCCTTTGTAATAATCTTCTTTATAGTTATGCCAATTATAATTGGAGGCTTTGGAAACTGATTAATTCCACTTATAATCGGAGCACCTGATATAGCTTTTCCTCGAATAAACAATATGAGTTTTTGACTACTACCTCCATCTTTCCTACTACTCTTGGCATCTTCCATAGTAGAAGCTGGGACAGGCACTGGTTGGACCGTATACCCTCCCCTGGCAGGAAACCTAGCCCATGCAGGAGCTTCTGTAGATTTAACTATTTTTTCACTTCACCTTGCAGGAGTATCCTCTATTTTAAGTGCAATTAATTTTATCACTACTATCATTAACATAAAACCTCCAGCTATGTCTCAATATCACATACCCTTATTTGTATGGTCCATTTTAATTACAGCCGTCCTTCTTCTTCTATCCCTCCCAGTTCTAGCAGCAGGTATTACAATATTATTAACGGATCGCAACCTCAATACTACTTTCTTTGACCCTGCAGGAGGAGGAGACCCAATTCTATACCAACACCTATTCTGGTTTTTTGGACACCCTGAAGTCTATATTCTAATCCTCCCAGGATTTGGAATAGTTTCTCATATCGTTACGTACTACTCAGGGAAAAAAGAACCCTTCGGTTATATAGGAATAGTATGGGCTATAATATCAATTGGCTTCCTAGGGTTCATTGTATGAGCCCACCATATATTCACTGTAGGCATAGACGTCGACACTCGAGCCTACTTTACATCCGCTACTATAATTATTGCTATTCCAACTGGCGTAAAAGTCTTTAGTTGACTAGCTACCCTTCATGGCGGTAATATTAAATGATCCCCCGCTATAATATGAGCCCTAGGATTTATCTTCTTATTTACAATTGGAGGGTTAACTGGCATTGTTCTTGCCAATTCTTCACTAGACATTGTCCTACATGATACCTACTACGTTGTAGCTCACTTTCACTACGTCCTATCTATAGGTGCAGTTTTCGCCATTATGGGTGGGTTTATCCACTGATTTCCACTATTTTCAGGGTACACATTAAACCATACATGAGCCAAAATTCAATTTCTAGTTATATTTATCGGTGTTAATTTGACATTCTTTCCCCAACACTTTCTTGGACTATCTGGTATACCACGTCGATATTCTGACTATCCAGATGCCTACACTGCATGAAATACTGCTTCTTCTATAGGCTCATTTATCTCTTTAGTAGCCGTAATTCTAATGGTCTTCATAATTTGAGAGGCATTTGCTTCTAAGCGCGAAGTTTCTGTGATAGAACTCACAACAACAAACGTAGAATGACTCAACGGATGTCCACCTCCACATCATACATTCGAAGAACCAGCCTACGTAAAATCTAACTCGAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mammuthus primigenius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Woolly mammoth

The woolly mammoth (Mammuthus primigenius), also called the tundra mammoth, is a species of mammoth. This animal is known from bones and frozen carcasses from northern North America and northern Eurasia with the best preserved carcasses in Siberia. They are perhaps the most well known species of mammoth.

This mammoth species was first recorded in (possibly 150,000 years old) deposits of the second last glaciation in Eurasia. It was derived from the steppe mammoth (Mammuthus armeniacus).[1]

It disappeared from most of its range at the end of the Pleistocene (10,000 years ago), with a dwarfed race still living on Wrangel Island until roughly 1700 BC.[2]

Contents

Description

Restoration of a herd in a late Pleistocene landscape of northern Spain

Woolly mammoths are common in the fossil record. Unlike most other prehistoric animals, their remains are often not literally fossilised - that is, turned into stone - but rather are preserved in their organic state. This is due in part to the frozen climate of their habitats, and to their massive size. Woolly mammoths are therefore among the best-understood prehistoric vertebrates known to science in terms of anatomy.[3]

Woolly mammoths lived in two groups which are speculated to be divergent enough to be characterised as subspecies. One group stayed in the middle of the high Arctic, while the other group had a much wider range.[4] The Bering Land Bridge likely played an important role in structuring woolly mammoth populations, acting as an ecological barrier.[5] Recent stable isotope studies of Siberian and New World mammoths has shown there were also differences in climatic conditions on either side of the Bering Land Bridge, with Siberia being more uniformly colder and drier throughout the Late Pleistocene.[6]

While woolly mammoths were not noticeably taller than present-day African elephants, they were larger and heavier. Fully grown mammoth bulls reached heights between 2.8 m (9.2 ft) and 4.0 m (13.1 ft); the dwarf varieties reached between 1.8 m (5.9 ft) and 2.3 m (7.5 ft).[7] They could weigh up to 8 tonnes (8.8 tons).[citation needed]

Woolly mammoth cave art from Dordogne, France

Woolly mammoths had a number of adaptations to the cold, most famously the thick layer of shaggy hair, up to 1 meter in length, with a fine underwool, for which the woolly mammoth is named. The coats were similar to those of muskoxen, and it is likely mammoths moulted in summer. They also had far smaller ears than modern elephants; the largest mammoth ear found so far was only 30 cm (12 in) long, compared to 180 cm (71 in) for an African elephant. Their skin was no thicker than that of present-day elephants, but unlike elephants, they had numerous sebaceous glands in their skin which secreted greasy fat into their hair, improving its insulating qualities. They had a layer of fat up to 8 cm (3.1 in) thick under the skin which, like the blubber of whales, helped to keep them warm. Similar to reindeer and musk oxen, their haemoglobin was adapted to the cold, with three genetic mutations to improve oxygen delivery around the body and prevent freezing.[8]

Other characteristic features included a high, peaked head that appears knob-like in many cave paintings, and a high shoulder hump resulting from long spinous processes on the neck vertebrae that probably carried fat deposits. Another feature at times found in cave paintings was confirmed by the discovery of the nearly intact remains of a baby mammoth named Dima. Unlike the trunk lobes of living elephants, Dima's upper lip at the tip of the trunk had a broad lobe feature, while the lower lip had a broad, squarish flap. Their teeth were also adapted to their diet of coarse tundra grasses, with more plates and a higher crown than their southern relatives.

Woolly mammoths had extremely long tusks — up to 5 m (16 ft) long — which were markedly curved, to a much greater extent than those of elephants. It is not clear whether the tusks were a specific adaptation to their environment; mammoths may have used their tusks as shovels to clear snow from the ground and reach the vegetation buried below. This is evidenced by flat sections on the ventral surface of some tusks. It has also been observed in many specimens that there may be an amount of wear on top of the tusk that would suggest some animals had a preference as to which tusk on which they rested their trunks.

Woolly mammoth fur

While preserved specimens of mammoth hair are "a kind of orangey colour", this is believed to be an artifact due to the leaching of pigment during burial. On 6 July 2006, The University of California, San Diego reported they had sequenced the Mc1r gene that influences hair colour in mammals from woolly mammoth bones. Two versions were found, a fully active (dominant) and a partially active (recessive) gene. In mammals, a partially active Mc1r gene results in red or yellow hair. Mammoths born with one copy of the active gene and one of the partially active gene would have had dark brown or black coats while those with two copies of the inactive gene would have had pale coats, possibly blond or ginger. Varying colours in mammals is usually a form of camouflage linked to survival. The scientists said they were unsure why different coloured mammoths existed as it is unlikely that it would have been an effective survival trait.[9]

Extinction

Most woolly mammoth populations disappeared during the late Pleistocene and early Holocene,[10] likely due to the combined effects of climate change and hunting by humans. A 2008 study by scientists at Spain's Museo Nacional de Ciencias Naturales estimated that changes in climate shrank suitable mammoth habitat from 7,700,000 km2 (3,000,000 sq mi) 42,000 years ago to 800,000 km2 (310,000 sq mi) 6,000 years ago.[11][12] Although woolly mammoths survived an even greater loss of habitat at the end of the Saale glaciation 125,000 years ago, at the end of the last ice age humans likely hunted remaining populations to extinction, the same fate that befell many other large Pleistocene animals.[13][14]

A small population of woolly mammoths survived on St. Paul Island, Alaska, until 3,750 BC,[15][16][17] while another remained on Wrangel Island in the Arctic Ocean until 1700 BC.[18] Possibly due to their limited food supply, these animals were a dwarf variety, much smaller than the original Pleistocene woolly mammoth.[19]

A 2010 study hypothesizes that the decline of the woolly mammoth could have increased temperatures by up to 0.2°C at high latitudes in the northern hemisphere.[20] Mammoths frequently ate birch trees, creating a grassland habitat. With the disappearance of mammoths, birch forests, which absorb more sunlight than grasslands, expanded, leading to regional warming.

History of discovery

A mammoth tusk with Eskimo carvings of scenes on the Yukon River, 19th century

Indigenous peoples of Siberia had long found what are now known to be woolly mammoth remains, collecting their tusks for the ivory trade. Native Siberians believed these remains to be those of giant mole-like animals that lived underground and died when burrowing to the surface.[21] During the 17th century, reports of these finds would occasionally reach Europe. Europeans generally interpreted the stories based on biblical accounts, as either the remains of behemoths or giants.[3] The word mammoth first entered the English language during this same period, derived from the local Russian word for the remains, mammant.[22]

The first woolly mammoth remains studied by European scientists were examined by British scientist Hans Sloane in 1728, and consisted of fossilised teeth and tusks from Siberia. Publishing his findings, Sloane became the first to recognise the remains did not belong to giants or behemoths, but rather to elephants. Sloane turned to another biblical explanation for the presence of elephants in the Arctic: he believed they had been buried during the biblical Great Flood, and that Siberia had previously been tropical prior to a drastic climate change. Others interpreted Sloane's conclusion slightly differently, arguing the flood had carried elephants from the tropics to the arctic.[3]

Illustration of the Adams mammoth's skeleton, 1815

It was French scientist Georges Cuvier who, in 1796, first identified the woolly mammoth remains not as modern elephants transported to the Arctic, but as an entirely new species. Most significantly, he argued this species had gone extinct and no longer existed, a concept that was not widely accepted at the time. (See Extinction section above).[23] Following Cuvier's identification, Johann Friedrich Blumenbach gave the woolly mammoth its scientific name in 1799, Elephas primigenius (placing it in the same genus as the Indian elephant). It was not until 1828 that Joshua Brookes recognised the species was distinct enough to warrant a new genus, and reclassified it as Mammuthus primigenius.[3]

Meanwhile, woolly mammoth remains were also being unearthed for the first time in North America. Mark Catesby noted several large teeth dug up in North Carolina in 1743, which African slaves identified as the molars of an elephant. In 1806, William Clark (on a fossil-hunting expedition ordered by President Thomas Jefferson) collected several woolly mammoth specimens from Kentucky.[3] Incidentally, Jefferson (who famously had a keen interest in paleontology) is also partially responsible for transforming the word mammoth from a noun describing the prehistoric elephant to an adjective describing anything amazingly large. The first recorded use of the word as an adjective was in a description of a large wheel of cheese given to Jefferson as a gift.[22]

Frozen remains

The stuffed Beresovka mammoth, in The Museum of Zoology, St. Petersburg[24]

While frozen mammoth carcasses had been excavated by Europeans as early as 1728 (by German scientist Daniel Messerschmidt), the first mammoth fossil fully documented by modern science was discovered near the delta of the Lena River in 1799 by Ossip Schumachov, a Siberian hunter. Schumachov allowed it to thaw (a process taking several years) until he could retrieve the tusks for sale to the ivory trade in Yakutsk. He then abandoned the specimen, allowing it to largely decay before its recovery, possibly even having been partially devoured by modern wolves.[3][25] In 1806, Russian botanist Mikhail Adams rescued what remained of the specimen and brought it to the Zoological Museum of the Zoological Institute of the Russian Academy of Sciences in St. Petersburg for study. The specimen, which became known as the Adams mammoth, was stuffed and mounted, and continues to be on display at the Zoological Institute.[3]

Preserved frozen remains of woolly mammoths, with much soft tissue remaining, have been found in the northern parts of Siberia. This is a rare occurrence, essentially requiring the animal to have been buried rapidly in liquid or semi-solids such as silt, mud and icy water, which then froze. This may have occurred in a number of ways. Mammoths may have been trapped in bogs or quicksands and either died of starvation or exposure, or drowning if they sank under the surface. The evidence of undigested food in the stomach and seed pods still in the mouth of many of the specimens suggests neither starvation nor exposure are likely. The maturity of this ingested vegetation places the time period in autumn rather than in spring when flowers would be expected.[26] The animals may have fallen through ice into small ponds or potholes, entombing them. Many are certainly known to have been killed in rivers, perhaps through being swept away by river floods. In one location, by the Berelekh River in Yakutia in Siberia, more than 8,000 bones from at least 140 individual mammoths have been found in a single spot, apparently having been swept there by the current.[27][28]

The preserved baby woolly mammoth named Dima

In 1977, the well-preserved carcass of a seven- to eight-month-old baby woolly mammoth, named "Dima", was discovered. This carcass was recovered from permafrost on a tributary of the Kolyma River in northeastern Siberia. This baby woolly mammoth weighed approximately 100 kg (220 lb) at death and was 104 cm (41 in) high and 115 cm (45 in) long. Radiocarbon dating determined Dima died about 40,000 years ago. Its internal organs are similar to those of living elephants, but its ears are only one-tenth the size of those of an African elephant of similar age.[1]

In the summer of 1997, a Dolgan family named Jarkov discovered a piece of mammoth tusk protruding from the tundra of the Taymyr Peninsula in Siberia, Russia. In September/October 1999, this 20,380-year-old carcass and 25 tons of surrounding sediment were transported by an Mi-26 heavy lift helicopter to an ice cave in Khatanga, Taymyr Autonomous Okrug. In October 2000, the careful defrosting operations in this cave began with the use of hairdryers to keep the hair and other soft tissues intact.[29][30]

Lyuba at the Field Museum.

In May 2007, the carcass of a female woolly mammoth calf (Lyuba) was discovered encased in a layer of permafrost near the Yuribei River in Russia, where it had been buried for 37,000 years. Scientists originally estimated Lyuba's age at four months. By slicing open her second premolar and analyzing its growth lines—similar to the rings in a tree, though, they found only one month had passed between her birth and death. Alexei Tikhonov, the Russian Academy of Science's Zoological Institutes's deputy director, has dismissed the prospect of cloning the animal, as the whole cells required for cloning would have burst under the freezing conditions; however, DNA is expected to be well-preserved enough to be useful for research on mammoth phylogeny and perhaps physiology.[31][32]

By 1929, the remains of thirty-four mammoths with frozen soft tissues (skin, flesh, or organs) had been documented. Only four of them were relatively complete. Since then, about that many more have been found. In most cases, the flesh shows signs of decay before its freezing and later desiccation. Stories abound about frozen mammoth carcasses that were still edible once defrosted, but the original sources indicate the carcasses were, in fact, terribly decayed, and the stench so unbearable that only the dogs accompanying the finders, and wild scavengers, showed any interest in the flesh.[33]

In addition to frozen carcasses, large amounts of mammoth ivory have been found in Siberia. Mammoth tusks have been articles of trade for at least 2,000 years.[citation needed] They have been and are still a highly prized commodity. Güyük, the 13th century Khan of the Mongols, is reputed to have sat on a throne made from mammoth ivory,[34] and even today it is in great demand as a replacement for the now-banned export of elephant ivory.

Genetics and possibilities for cloning

Since there is a known case in which an Asian elephant and an African elephant have produced a live (though sickly) offspring, it has been theorised that if mammoths were still alive today, they would be able to interbreed with Indian elephants. This has led to the idea[35] that perhaps a mammoth-like creature could be recreated by taking genetic material from a frozen mammoth and combining it with that from a modern Indian elephant.

Section through an ivory tooth (tusk) of a mammoth

Scientists hope to retrieve the preserved reproductive organs of a frozen mammoth and revive its sperm cells. However, not enough genetic material has been found in frozen mammoths for this to be attempted. Another possibility for recreating the mammoth is cloning. Fox News reported a team of Japanese scientists feels they are getting closer to this goal. A November 4, 2008 article states they were successful in finding useful DNA of mice that had been frozen for 16 years. The scientists did so by looking in the brain, where high concentrations of sugar had preserved the DNA. They hope to use similar methods to find usable mammoth DNA and implant it into unfertilised Asian elephant eggs.[36]

In spite of not yet being able to retrieve this usable DNA, the scientific community has been successful in studying the phylogeography of the woolly mammoth[37] and determining the complete mitochondrial genome sequence of Mammuthus primigenius.[38] The analysis demonstrates the divergence of mammoth, African elephant, and Asian elephant occurred over a short time, and confirmed the mammoth was more closely related to the Asian than to the African elephant. As an important landmark in this direction, in December 2005, a team of American, German, and UK researchers were able to assemble a complete mitochondrial DNA profile of the mammoth, which allowed them to trace the close evolutionary relationship between mammoths and Asian elephants. African elephants branched away from the woolly mammoth around 6 million years ago, a moment in time close to that of the similar split between chimps and humans. Before the publication of the Neanderthal genome, many researchers expected the first fully sequenced nuclear genome of an extinct species would be that of the mammoth.

On 6 July 2006, the extraction, amplification and sequencing of Mc1r, a gene that influences hair colour in mammals, from a 43,000-year old woolly mammoth bone from Siberia was reported.[9]

In November 2008, two professors from Penn State University – Stephan Schuster, professor of biochemistry and molecular biology, and Webb Miller, professor of biology, computer science and engineering – were reported to have mapped much of the woolly mammoth's DNA. Their research discovered there were two distinct groups of woolly mammoths: one which went extinct 45,000 years ago, and a different one which went extinct in 10,000 BC. Their research also showed the DNA of the woolly mammoth and the African elephant are 98.55%[39] to 99.4%[40] identical. While the authors admit they do not know the full size of the genome, they believe they have sequenced about 50% from random fragments.[41]

The team mapped the mammoth's nuclear genome sequence by extracting DNA from the hair follicle of a 20,000 year old mammoth retrieved from permafrost and from another mammoth which died some 60,000 years ago. Using hair avoids the problems of DNA contamination caused by bacteria and fungi. Hair follicles preserve DNA because of the plastic-like protection afforded by the hair material.[42]

In January 2011, it was reported[43] by Yomiuri Shimbun that a team of scientists headed by Akira Iritani of Kyoto University had built upon research by Dr. Teruhiko Wakayama of RIKEN in Kobe, Japan, saying that they will extract DNA from a mammoth carcass that had been preserved in a Russian laboratory and insert it into the egg cells of an African elephant in hopes of producing a mammoth embryo. The researchers said they hoped to produce a baby mammoth within six years.[44]

Cryptozoology

Woolly mammoth at the Royal BC Museum, Victoria, British Columbia.

There have been occasional claims that the woolly mammoth is not actually extinct, and that small isolated herds might survive in the vast and sparsely inhabited tundra of the Northern Hemisphere. In the late nineteenth century, there were, according to Bengt Sjögren (1962), persistent rumors about surviving mammoths hiding in Alaska.[45] In October 1899, a story about a man named Henry Tukeman detailed his having killed a mammoth in Alaska and that he subsequently donated the specimen to the Smithsonian Institution in Washington, D.C. The museum denied the existence of any mammoth corpse, and the story turned out to be a hoax.[46] Sjögren (1962) believes the myth was started when the American biologist Charles Haskins Townsend travelled in Alaska, saw Eskimos trading mammoth tusks, asked if there still were living mammoths in Alaska and provided them with a drawing of the animal.

In the nineteenth century, several reports of "large shaggy beasts" were passed on to the Russian authorities by Siberian tribesman, but no scientific proof ever surfaced. A French chargé d'affaires working in Vladivostok, M. Gallon, claimed in 1946 that in 1920 he met a Russian fur-trapper who claimed to have seen living giant, furry "elephants" deep into the taiga. Gallon added that the fur-trapper did not even know about mammoths before, and he talked about the mammoths as a forest-animal at a time when they were seen as living on the tundra and snow.[45]

In legends

12.500 year old Atlatl from France, carved as a woolly mammoth[47]

Legends from dozens of Native American tribes have been interpreted by some as indicative of Proboscidea.[48][49][50][51][52] One example is from the Kaska tribe from northern British Columbia; in 1917 an ethnologist recorded their tradition of: “A very large kind of animal which roamed the country a long time ago. It corresponded somewhat to white men's pictures of elephants. It was of huge size, in build like an elephant, had tusks, and was hairy. These animals were seen not so very long ago, it is said, generally singly, but none have been seen now for several generations. Indians come across their bones occasionally. The narrator said he and some others, a few years ago, came on a shoulder-blade... as wide as a table (about three feet).” However, the animal in this story was predatory and carnivorous, suggesting the memory of the proboscideans had become conflated with that of other megafauna, such as bears and sabertooths.[53][54]

References

  1. ^ a b "Yukon Beringia Interpretive Centre - Woolly Mammoth". www.beringia.com. http://www.beringia.com/research/woolly_mammoth.html. Retrieved 2009-03-26. 
  2. ^ Nowak, Ronald M. (1999). Walker's Mammals of the World. Baltimore: Johns Hopkins University Press. ISBN 0801857899. 
  3. ^ a b c d e f g The Academy of Natural Sciences (2007). "Woolly Mammoth (Mammuthus primigenius)". The Academy of Natural Sciences. http://www.ansp.org/museum/jefferson/otherFossils/mammuthus.php. Retrieved September 29, 2007. 
  4. ^ Gilbert, M. Thomas P.; et al. (2008). "Intraspecific phylogenetic analysis of Siberian woolly mammoths using complete mitochondrial genomes". PNAS 105 (24): 8327–8332. doi:10.1073/pnas.0802315105. PMC 2423413. PMID 18541911. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2423413. 
  5. ^ Guthrie, R. Dale (2001). "Origin and causes of the mammoth steppe: a story of cloud cover, woolly mammoth tooth pits, buckles, and inside-out Beringia". Quaternary Science Reviews 20 (1-3): 549–574. doi:10.1016/S0277-3791(00)00099-8. http://www.sciencedirect.com/science/article/B6VBC-41XM80M-1C/2/2a61c93a886ba8da00efd6e459d80761. 
  6. ^ Szpak, Paul; "Gröcke, D.R., Debruyne, R., MacPhee, R.D.E., Guthrie, R.D., Froese, D., Zazula, G.D., Patterson, W.P., Poinar, H.N." (2010). "Regional differences in bone collagen δ13C and δ15N of Pleistocene mammoths: Implications for paleoecology of the mammoth steppe". Palaeogeography, Palaeoclimatology, Palaeoecology 268 (1-2): 88–96. doi:10.1016/j.palaeo.2009.12.009. http://uwo.academia.edu/PaulSzpak/Papers/156300/Regional-differences-in-bone-collagen-%CE%B413C-and-%CE%B415N-of-Pleistocene-mammoths--Implications-for-paleoecology-of-the-mammoth-steppe. 
  7. ^ "CAUSES OF NORTHERN GIANTS' EXTINCTION". http://dlib.eastview.com/browse/doc/16091691. 
  8. ^ Smith, Lewis (2 May 2010). "Woolly mammoths evolved 'anti-freeze blood'". The Independent (London). http://www.independent.co.uk/news/science/woolly-mammoths-evolved-antifreeze-blood-1960723.html. Retrieved 2 May 2010. 
  9. ^ a b Römpler, H.; et al. (2006). "Nuclear Gene Indicates Coat-Color Polymorphism in Mammoths" (PDF). Science 313 (5783): 62. doi:10.1126/science.1128994. PMID 16825562. http://people.ibest.uidaho.edu/~bree/courses/19_Rompler_2006.pdf. 
  10. ^ Stuart, Anthony J.; et al. (2002). "The latest woolly mammoths (Mammuthus primigenius Blumenbach) in Europe and Asia: a review of the current evidence". Quaternary Science Reviews 21 (14–15): 1559–1569. doi:10.1016/S0277-3791(02)00026-4. 
  11. ^ Nogués-Bravo, D.; Rodríguez, J.; Hortal, J.; Batra, P.; Araújo, M. B. (2008). Barnosky, Anthony. ed. "Climate Change, Humans, and the Extinction of the Woolly Mammoth". PLoS Biology 6 (4): e79. doi:10.1371/journal.pbio.0060079. PMC 2276529. PMID 18384234. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2276529. 
  12. ^ Sedwick, Caitlin (2008). "What Killed the Woolly Mammoth?". PLoS Biology 6 (4): e99. doi:10.1371/journal.pbio.0060099. PMC 2276526. PMID 20076709. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2276526. 
  13. ^ Martin, P. S (2005). Twilight of the Mammoths: Ice Age Extinctions and the Rewilding of America. University of California Press. ISBN 0520231414. http://www.google.com/books?id=eThoCsL1hRAC&printsec=frontcover. 
  14. ^ Burney, D. A.; Flannery, T. F. (July 2005). "Fifty millennia of catastrophic extinctions after human contact". Trends in Ecology & Evolution (Elsevier) 20 (7): 395–401. doi:10.1016/j.tree.2005.04.022. PMID 16701402. http://www.anthropology.hawaii.edu/Fieldschools/Kauai/Publications/Publication%204.pdf. Retrieved 2009-06-12. 
  15. ^ David R. Yesner, Douglas W. Veltre, Kristine J. Crossen, and Russell W. Graham, “5,700-year-old Mammoth Remains from Qagnax Cave, Pribilof Islands, Alaska”, Second World of Elephants Congress, (Hot Springs: Mammoth Site, 2005), 200-203.
  16. ^ Kristine J. Crossen, “5,700-Year-Old Mammoth Remains from the Pribilof Islands, Alaska: Last Outpost of North America Megafauna”, Geological Society of America Abstracts with Programs, Volume 37, Number 7, (Geological Society of America, 2005), 463.
  17. ^ Guthrie, R. Dale (2004). "Radiocarbon evidence of mid-Holocene mammoths stranded on an Alaskan Bering Sea island". Nature 429 (6993): 746–749. doi:10.1038/nature02612. PMID 15201907. 
  18. ^ Stuart, A.J.; Kosintsev, P.A.; Higham, T.F.G.; Lister, A.M. (2004). "Pleistocene to Holocene extinction dynamics in giant deer and wooly mammoth". Nature 431: 684–689. doi:10.1038/nature02890. http://www.nature.com/nature/journal/v431/n7009/abs/nature02890.html. Retrieved 2011-09-05. 
  19. ^ Vartanyan, S. L.; Garutt, V. E.; Sher, A. V. (1993). "Holocene dwarf mammoths from Wrangel Island in the Siberian Arctic". Nature 362 (6418): 337–349. doi:10.1038/362337a0. 
  20. ^ Doughty, Christopher E.; Wolf, Adam; Field, Christopher B. (2010). "Biophysical feedbacks between the Pleistocene megafauna extinction and climate: The first human-induced global warming?". Geophysical Research Letters 37 (15): 15703. Bibcode 2010GeoRL..3715703D. doi:10.1029/2010GL043985. 
  21. ^ Breyne, J. Phil.; S., T.; Wolochowicz, M. (1737). "A Letter from John Phil. Breyne, M. D. F. R. S. To Sir Hans Sloane, Bart. Pres. R. S. With Observations, and a Description of Some Mammoth's Bones Dug up in Siberia, Proving Them to Have Belonged to Elephants". Philosophical Transactions of the Royal Society of London 40 (445–451): 124–138. doi:10.1098/rstl.1737.0026. 
  22. ^ a b Simpson, J. (2009). "Word Stories: Mammoth." Oxford English Dictionary Online, Oxford University Press. Accessed 05-JUN-2009.
  23. ^ Cuvier, G. (1796). "Mémoire sur les épèces d'elephans tant vivantes que fossils, lu à la séance publique de l'Institut National le 15 germinal, an IV." Magasin encyclopédique, 2e anée, 3: 440-445. [In French].
  24. ^ "National Geographic photo gallery". Ngm.nationalgeographic.com. May 2009. http://ngm.nationalgeographic.com/2009/05/mammoths/latreille-photography. Retrieved 2010-06-22. 
  25. ^ Granqvist, Eirik (2005). Mammouth - from their discovery and how to bring them the life. Paper from the NATHIST annual meeting in Jakobstad. http://www.icom-nathist.de/icom/jakobstad2005_granqvist.htm. 
  26. ^ E. W. Pfizenmayer was one of the scientists who recovered and studied a mammoth that was found at the river Berezovka in the early 1900s. He wrote: “Its death must have occurred very quickly after its fall, for we found half-chewed food still in its mouth, between the back teeth and on its tongue, which was in good preservation. The food consisted of leaves and grasses, some of the latter carrying seeds. We could tell from these that the mammoth must have come to its miserable end in the autumn.” See Pfizenmayer, E. W. (1939). Siberian Man and Mammoth. London: Blackie and Son. 
  27. ^ "Nikolai K. Vereschagin, "The Mammoth Expert," Dies at Age 99". Society of Vertebrate Paleontology. May 22, 2009. http://www.vertpaleo.org/source/blog/post.cfm/nikolai-k-vereschagin-the-mammoth-expert-dies-at-age-99. "In the 1970s, Dr. Vereschagin headed paleontological expeditions to the later well-known “Berelekh Mammoth Boneyard” site on the Berelekh River in Yakutia Republic. Here, he and his colleagues collected more than 8,000 bones, belonging to at least 140 woolly mammoth individuals, from sand lenses formed by the River." 
  28. ^ Vereshchagin, N. K. (1974). "The mammoth "cemeteries" of north-east Siberia". Polar Record 17 (106): 3–12. doi:10.1017/S0032247400031296. "The total number of skeletal remains exceeded 8500 bones, predominantly mammoth bones. [...] We found about 140 individual mammoths in the Berelekh cemetery." 
  29. ^ Mol, D. et al. (2001). The Jarkov Mammoth: 20,000-Year-Old carcass of a Siberian woolly mammoth Mammuthus primigenius (Blumenbach, 1799). The World of Elephants, Proceedings of the 1st International Congress (October 16–20, 2001, Rome): 305-309. Full text pdf
  30. ^ Debruyne, Régis; et al. (2003). "Mitochondrial cytochrome b of the Lyakhov mammoth (Proboscidea, Mammalia): new data and phylogenetic analyses of Elephantidae". Molecular Phylogenetics and Evolution 26 (3): 421–434. doi:10.1016/S1055-7903(02)00292-0. PMID 12644401. 
  31. ^ Rincon, Paul (2007-07-10). "Baby mammoth discovery unveiled". news.bbc.co.uk (The BBC). http://news.bbc.co.uk/1/hi/sci/tech/6284214.stm. Retrieved 2007-07-13. 
  32. ^ Solovyov, Dmitry (2007-07-11). "Baby mammoth find promises breakthrough". reuters.com (Reuters). http://www.reuters.com/article/scienceNews/idUSL1178205120070711. Retrieved 2007-07-13. 
  33. ^ Farrand, William R. (1961). "Frozen Mammoths and Modern Geology: The death of the giants can be explained as a hazard of tundra life, without evoking catastrophic events". Science 133 (3455): 729–735. doi:10.1126/science.133.3455.729. PMID 17777646. 
  34. ^ Tolmachoff, I. P. (1929). "The Carcasses of the Mammoth and Rhinoceros Found in the Frozen Ground of Siberia". Transactions of the American Philosophical Society (American Philosophical Society) 23 (1): i–74b. doi:10.2307/1005437. JSTOR 1005437. 
  35. ^ http://discovermagazine.com/1999/apr/cover
  36. ^ "Cloned Mammoths Made More Likely by Frozen Mice". FOX News. 2008-11-05. http://www.foxnews.com/story/0,2933,446570,00.html. Retrieved 2008-11-04. 
  37. ^ Debruyne, Regis; Chu, G., King, Christine E., Bos, Kirsti, Kuch, Melanie, Schwarz, Carsten, Szpak, Paul, Gröcke, Darren R., Matheus, P., Zazula, Grant, Guthrie, Dale, Froese, Duane, Buigues, B., de Marliave, C., Flemming, C., Poinar, D., Fisher, Dan, Southon, John, Tikhonov, Alexei N., MacPhee, Ross D.E., Poinar, Hendrik N. (2008). "Out of America: Ancient DNA evidence for a New World origin of Late Quaternary woolly mammoths". Current Biology 18 (17): 1320–1326. doi:10.1016/j.cub.2008.07.061. PMID 18771918. http://uwo.academia.edu/PaulSzpak/Papers/156302/Out-of-America--ancient-DNA-evidence-for-a-New-World-origin-of-Late-Quaternary-woolly-mammoths. 
  38. ^ Krause, J.; et al. (2006). "Multiplex amplification of the mammoth mitochondrial genome and the evolution of Elephantidae". Nature 439 (7077): 724–727. doi:10.1038/nature04432. PMID 16362058. 
  39. ^ Metagenomics to paleogenomics: Large-scale sequencing of mammoth DNA[dead link]
  40. ^ Will findings recreate the woolly mammoth?, Pittsburgh Post-Gazette, November 20, 2008
  41. ^ Cosmos Online - Mammoth Genome Cracked: Key to Cloning? <http://www.cosmosmagazine.com/news/2346/mammoth-genome-cracked-key-cloning>
  42. ^ "Science Daily". Science Daily. 2008-11-20. http://www.sciencedaily.com/releases/2008/11/081119140712.htm. Retrieved 2010-06-22. 
  43. ^ http://www.yomiuri.co.jp/dy/features/science/T110108003296.htm
  44. ^ "Scientists trying to clone, resurrect extinct mammoth – This Just In". CNN. http://news.blogs.cnn.com/2011/01/17/scientists-trying-to-clone-resurrect-extinct-mammoth/?hpt=T2. 
  45. ^ a b Sjögren, Bengt. Farliga djur och djur som inte finns, Prisma, 1962
  46. ^ Murray, Morgan. "Henry Tukeman: Mammoth's Roar was Heard All The Way to the Smithsonian". www2.tpl.lib.wa.us. http://www2.tpl.lib.wa.us/v2/NWROOM/MORGAN/Tukeman.htm. Retrieved 2008-01-17. 
  47. ^ http://www.britishmuseum.org/explore/highlights/highlight_objects/pe_prb/s/mammoth_spear_thrower.aspx
  48. ^ Strong, W. D. (1934). "North American Indian Traditions Suggesting a Knowledge of the Mammoth". American Anthropologist 36: 81–88. doi:10.1525/aa.1934.36.1.02a00060. 
  49. ^ William Berryman Scott, “American Elephant Myths”, Scribner’s Magazine, Volume 1, (New York, C. Scribner’s Sons, 1887), 474-476, retrieved online October 2008 at www.archive.org/details/scribnersmag01editmiss.
  50. ^ Records of the Past Exploration Society, “Pre-Indian Inhabitants of North America, Part II, Man and the Elephant and Mastodon”, Records of the Past, (Washington D.C.: Records of the Past Exploration Society, 1907), 164, retrieved online October 2008 at books.google.com/books?id=7_HzBYM-7X4C
  51. ^ Lankford, G. E. (1980). "Pleistocene Animals in Folk Memory". The Journal of American Folklore 93 (369): 293–304. JSTOR 540573. 
  52. ^ Mayor, Adrienne (2005). Fossil Legends of the First Americans. Princeton: Princeton University Press. p. 97. ISBN 0-691-11345-9. 
  53. ^ Teit, J. A. (1917). "Kaska tales". The Journal of American Folklore 30 (118): 427–473 [450–451]. JSTOR 534495. http://www.archive.org/stream/kaskatales00teituoft#page/n1/mode/2up. Retrieved 1 April 2011. 
  54. ^ Examples of British Columbia Folklore: Bladder-Head Boy (A Kaska Woolly-Mammoth Legend), (The British Columbia Folklore Society, 2003).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!