Overview

Distribution

Range Description

P. t. schweinfurthii (Giglioli, 1872) ranges from the Ubangi River/Congo River in Central African Republic and the Democratic Republic of Congo, to western Uganda, Rwanda and western Tanzania (with small, relict populations in Burundi and south-eastern Sudan).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Chimpanzees are found predominantly in moist and dry forests, and forest galleries extending into savanna woodlands. They are omnivorous, and their diet is highly variable according to individual populations and seasons. Fruit comprises about half the diet, but leaves, bark, and stems are also important. Mammals comprise a small but significant component of the diet of many populations. Chimpanzees form social communities of 5 to 150 animals. Home ranges are larger in woodland forest mosaics than in mixed forest, and average 12.5 km² (range 5 to 400 km²).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pan troglodytes schweinfurthii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTACTATTCGGCGCATGGGCTGGAGTCCTGGGCACAGCCCTAAGTCTCCTTATTCGGGCTGAACTAGGCCAACCAGGCAACCTTCTAGGTAATGACCACATCTACAATGTCATCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACTGGCTAGTCCCCTTGATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTACCCCCTTCTCTCCTACTTCTACTTGCATCTGCCATAGTAGAAGCCGGCGCCGGAACAGGTTGAACGGTCTACCCTCCCTTAGCGGGAAACTACTCGCATCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTGCATCTGGCAGGCGTCTCCTCTATCCTAGGAGCCATTAACTTCATCACAACAATTATTAATATAAAACCTCCTGCCATAACCCAATACCAAACACCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCTTACTTCTCCTATCCCTCCCAGTCCTAGCTGCTGGCATCACCATACTATTGACAGATCGTAACCTCAACACTACCTTCTTCGATCCAGCCGGGGGAGGAGACCCTATTCTATATCAGCACTTATTCTGATTTTTTGGCCACCCCGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATTTCCCACATTGTAACTTATTACTCCGGAAAAAAAGAACCATTTGGATATATAGGCATGGTTTGAGCTATAATATCAATTGGTTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCCTATTTCACCTCCGCTACCATAATCATTGCTATTCCTACCGGCGTCAAAGTATTCAGCTGACTCGCTACACTTCACGGAAGCAATATGAAATGATCTGCCGCAGTACTCTGAGCCCTAGGGTTCATCTTTCTCTTTACCGTAGGTGGCCTAACCGGCATTGTACTAGCAAACTCATCATTAGACATCGTGCTACACGACACATACTACGTCGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCTGTATTCGCCATCATAGGAGGCTTCATCCACTGATTTCCCCTATTCTCAGGCTATACCCTAGACCAAACCTATGCCAAAATCCAATTTGCCATCATGTTCATCGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTTGGCCTATCTGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAATGTCCTATCATCCGTAGGCTCATTCATCTCCCTGACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTTGCTTCAAAACGAAAAGTCCTAATAGTAGAAGAGCCTTCCACAAACCTGGAATGACTGTATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pan troglodytes schweinfurthii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Wilson, M.L., Balmforth, Z., Cox, D., Davenport, T., Hart, J., Hicks, C., Hunt, K.D., Kamenya, S., Mitani, J.C., Moore, J., Nakamura, M, Nixon, S., Plumptre, A.J. & Reynolds, V.

Reviewer/s
Mittermeier, R.A. & Williamson, E.A. (Primate Red List Authority)

Contributor/s

Justification
Due to high levels of exploitation, loss of habitat and habitat quality as a result of expanding human activities, this subspecies is estimated to have experienced a significant population reduction in the past 20 to 30 years (one generation is estimated to be 20 years: Boesch and Boesch-Achermann 2000, Emery Thompson et al. in prep., Gombe long-term records, unpubl.) and it is suspected that this reduction will continue for the next 30 to 40 years. The maximum population reduction over a three-generation (i.e., 60 year) period from the 1970s to 2030 is suspected to exceed 50%, hence qualifying this taxon for Endangered under criterion A4. The causes of the reduction, although largely understood, have certainly not ceased and are not easily reversible. The suspected future continuation of the population reduction is a precautionary approach based on the rapidly increasing human population density in the region and the degree of political instability in some range states. Some populations of this subspecies appear to be stable, particularly east of the Albertine Rift, and in well-managed protected areas. However, even in these areas, human population growth, construction of new roads, and conversion of forest and woodland to agriculture are all expected to adversely affect chimpanzee populations.

History
  • 2007
    Endangered
  • 2000
    Endangered
  • 2000
    Endangered
  • 1996
    Endangered
  • 1988
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
See species-level assessment (Pan troglodytes).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
See species-level assessment (Pan troglodytes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
See species-level assessment (Pan troglodytes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eastern chimpanzee

The eastern chimpanzee (Pan troglodytes schweinfurthii) is a subspecies of the common chimpanzee. It occurs in the Central African Republic, the Sudan, the Democratic Republic of the Congo, Uganda, Rwanda, Burundi, and Tanzania.[3]

The 2007 IUCN Red List classified them as Endangered.[2] Although the common chimpanzee is the most abundant and widespread of the non-human great apes, recent declines in East Africa are expected to continue due to hunting and loss of habitat. Because chimpanzees and humans are so physiologically similar, chimpanzees succumb to many diseases that afflict humans.[4] If not properly managed, research and tourism also presents a risk of disease transmission between humans and chimpanzees.

This subspecies has been extensively studied by Dr. Jane Goodall at Gombe National Park.[4]

Contents

Physical description

Adult chimpanzees in the wild weigh between 40 and 65 kilograms (88 and 143 pounds). Males can measure up to 160 centimetres (63 inches) and females up to 130 centimetres (51 inches) in height. Although they are lighter than humans, they have a pull five to six times stronger. This is because the muscles of the common chimpanzee and other primates are far more effective than those of humans. The chimpanzees body is covered with coarse dark brown hair, except for the face, fingers, toes, palms of the hands and soles of the feet. Both of its thumbs and its big toes are opposable, allowing a precision grip.

Habitat

The chimpanzee will spend time both in trees and on the ground, but will usually sleep in a[clarification needed] tree where it will build a nest for the night. They once inhabited most of this region, but their habitat has been dramatically reduced in recent years.

Behavior

A group of chimps grooming
A nest on a tree where chimps sleep overnight

Chimpanzees live in communities that typically range from 20 to more than 150 members, but spend most of their time traveling in small parties of just a few individuals. The eastern chimpanzee is both arboreal and terrestrial and spend its nights in the trees, while most of its daytime hours are spent on the ground.[5]

Chimpanzees walk using the soles of their feet and their knuckles, and they can walk upright for short distances. Common chimpanzees are 'knuckle walkers', like gorillas,[5] in contrast to the quadrupedal locomotion (a form of land animal locomotion using four legs) of orangutans and bonobos known as 'palm walkers' who use the outside edge of their palms.

When confronted by a predator, chimpanzees will react with loud screams and use any object they can get against the threat. The leopard is the chimpanzee's main natural predator, but they have also fallen prey to lions.[6]

Diet

Male chimpanzee with its prey, a bushbuck

Like humans, chimpanzees are omnivorous, meaning their diet consists of plants and animals. Some of the foods a chimpanzee will eat include seeds, fruits, leaves, bark, insects such as termites and small prey. Chimpanzees will often use a twig as a tool to help them reach termites or ants in nests and have been seen using sticks to hunt other small mammals. There are also instances of organized hunting. In some cases, such as the killing of leopard cubs, this primarily seems to be a protective effort, since the leopard is the main natural predator of the common chimpanzee. However, the common chimpanzee sometimes bands together and hunts western red colobus monkeys (Piliocolobus badius) for meat. Isolated cases of cannibalism have also been documented.

See also

General:

References

  1. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 183. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3.
  2. ^ a b Wilson, M.L., Balmforth, Z., Cox, D., Davenport, T., Hart, J., Hicks, C., Hunt, K.D., Kamenya, S., Mitani, J.C., Moore, J., Nakamura, M, Nixon, S., Plumptre, A.J. & Reynolds, V. (2008). Pan troglodytes ssp. schweinfurthii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Hof, Jutta; Sommer, Volker: Apes Like Us: Portraits of a Kinship, Edition Panorama, Mannheim 2010, ISBN 978-3-89823-435-1, p. 114.
  4. ^ a b Goodall, J. (1996). McGrew, W.C., Marchant, L. F., & Nishida, T. eds. ed. Great Ape Societies. Cambridge: Cambridge University Press. p. xix. ISBN 0-521-55536-1. http://www.cambridge.org/gb/knowledge/isbn/item5708185/?site_locale=en_GB.
  5. ^ a b Janssen, Ellen and Paul (2006). "Chimpanzee Fact File". African Wildlife Foundation. http://www.outtoafrica.nl/animals/engchimpanzee.html. Retrieved 23 September 2012.
  6. ^ Boesch, Christophe (1991). "The Effects of Leopard Predation on Grouping Patterns in Forest Chimpanzees". Behaviour. 1991 117: 221–242. http://www.eva.mpg.de/primat/staff/boesch/pdf/behav_leopard_predation.pdf.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!