Overview

Distribution

Range Description

P. t. troglodytes (Blumenbach, 1799) ranges from Cameroon, south of the Sanaga River, to the Congo River/Ubangi River (Democratic Republic of Congo).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Chimpanzees are found predominantly in moist and dry forests, and forest galleries extending into savanna woodlands. They are omnivorous, and their diet is highly variable according to individual populations and seasons. Fruit comprises about half the diet, but leaves, bark, and stems are also important. Mammals comprise a small but significant component of the diet of many populations. Chimpanzees form social communities of 5 to 150 animals. Home ranges are larger in woodland forest mosaics than in mixed forest, and average 12.5 km² (range 5 to 400 km²).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pan troglodytes troglodytes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTACTATTCGGCGCATGGGCTGGAGTCCTGGGCACAGCCCTAAGTCTCCTTATTCGGGCTGAACTAGGCCAACCAGGCAACCTTCTAGGTAATGACCACATCTACAATGTCATCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACTGGCTAGTCCCCTTGATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTACCCCCTTCTCTCCTACTTCTACTTGCATCTGCCATAGTAGAAGCCGGCGCCGGAACAGGTTGAACAGTCTACCCTCCCTTAGCGGGAAACTACTCGCATCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTGCATCTGGCAGGCGTCTCCTCTATCCTAGGAGCCATTAACTTCATCACAACAATTATTAATATAAAACCTCCTGCCATAACCCAATACCAAACACCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCTTACTTCTCCTATCCCTCCCAGTCCTAGCTGCTGGCATCACCATACTATTGACAGATCGTAACCTCAACACTACCTTCTTCGATCCAGCCGGGGGAGGAGACCCTATTCTATATCAGCACTTATTCTGATTTTTTGGCCACCCCGAAGTTTATATTCTTATTCTACCAGGCTTCGGAATAATTTCCCACATTGTAACTTATTACTCCGGAAAAAAAGAACCATTTGGATATATAGGCATGGTTTGAGCTATAATATCAATTGGTTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCCTATTTCACCTCCGCTACCATAATCATTGCTATTCCTACCGGCGTCAAAGTATTCAGCTGACTCGCTACACTTCACGGAAGCAATATGAAATGATCTGCCGCAGTACTCTGAGCCCTAGGGTTCATCTTTCTCTTTACCGTAGGTGGCCTAACCGGCATTGTACTAGCAAACTCATCATTAGACATCGTGCTACACGACACATACTACGTCGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCTGTATTCGCCATCATAGGAGGCTTCATTCACTGATTCCCCCTATTCTCAGGCTATACCCTAGACCAAACCTATGCCAAAATCCAATTTGCCATCATGTTCATTGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTTGGCCTATCTGGGATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAATGTCCTATCATCCGTAGGCTCATTCATCTCCCTGACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTTGCTTCAAAACGAAAAGTCCTAATAGTAGAAGAACCTTCCACAAACCTGGAATGACTGTACGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAAACAAAAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pan troglodytes troglodytes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4cde

Version
3.1

Year Assessed
2008

Assessor/s
Tutin, C.E.G., Baillie, J.E.M., Dupain, J., Gatti, S., Maisels, F., Stokes, E.J., Morgan, D.B. & Walsh, P.D.

Reviewer/s
Mittermeier, R.A., Butynski, T.M. & Williamson, E.A. (Primate Red List Authority)

Contributor/s

Justification
Due to high levels of exploitation, loss of habitat and habitat quality as a result of expanding human activities, and disease (Ebola), this subspecies is estimated to have experienced a significant population reduction in the past 20 to 30 years (one generation is estimated to be 20 years: Boesch and Boesch-Achermann 2000, Emery Thompson et al. in prep., Gombe long-term records, unpubl.) and it is suspected that this reduction will continue for the next 30 to 40 years. The maximum population reduction over a three-generation (i.e., 60 year) period from the 1970s to 2030 is suspected to exceed 50%, hence qualifying this taxon for Endangered under criterion A4. The causes of the reduction, although largely understood, have certainly not ceased and are not easily reversible. The suspected future continuation of the population reduction is a precautionary approach based on the rapidly increasing human population density in the region and the high degree of political instability in the range states. There is evidence that Ebola will continue to spread (Walsh et al. 2005, Lahm et al. 2006) and it is too early to judge whether or not chimpanzee populations will recover from the extremely high levels of Ebola-induced mortality. Recovery will take a very long time even in ideal conditions of complete protection from hunting.

History
  • 2007
    Endangered
  • 2000
    Endangered
  • 2000
    Endangered
  • 1996
    Endangered
  • 1988
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
See species-level assessment (Pan troglodytes).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
See species-level assessment (Pan troglodytes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
See species-level assessment (Pan troglodytes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Central chimpanzee

The central chimpanzee or Tschego (Pan troglodytes troglodytes) is a subspecies of the common chimpanzee (one of the closest living relatives to humans, along with the bonobo). It occurs mainly in Gabon, Cameroon, and the Republic of the Congo, but also, to a lesser extent, in other regions.

Contents

Etymology

Pan is derived from the Greek god of fields, groves, and wooded glens, Pan. Troglodytes is Greek for 'cave-dweller', and was coined by Johann Friedrich Blumenbach in his Handbuch der Naturgeschichte (Handbook of Natural History) published in 1779.

Classification

The central chimpanzee is considered a subspecies of the common chimpanzee (Pan troglodytes), along with the western chimpanzee (P. t. verus), the Nigeria-Cameroon chimpanzee (P. t. vellerosus), and the eastern chimpanzee (P. t. schweinfurthii).[3]

Distribution and habitat

The central chimpanzee occurs in Central Africa, mainly in Gabon, Cameroon, and Republic of the Congo, but also in the Central African Republic, Equatorial Guinea, the Cabinda exclave of Angola, south-east Nigeria, and (possibly) the coastal extension of the Democratic Republic of the Congo. Its range extends north to the Sanaga River in Cameroon, east to the Ubangi River that defines the border between the two Congos, and south to the Congo River, which defines a large part of the same border.[2][4]

Chimpanzees are found predominantly in tropical moist forests and wet savanna woodlands, as well as the forest-savanna mosaics where these two biomes meet, from sea level to 3,000 metres (9,800 ft).[5] They tend to have larger ranges in the forest-savanna mosaics.[2] The average range is 12.5 km2 (4.8 sq mi), but can vary from 5 km2 (1.9 sq mi) to 400 km2 (150 sq mi).[2]

Conservation

The 2007 International Union for Conservation of Nature (IUCN) Red List of Threatened Species classifies the central chimpanzee as Endangered.[2] In 1988 they were considered "Vulnerable", but have been considered "Endangered" since at least 1996.[2] The World Wildlife Fund (WWF) estimates there are as many as 115,000 individuals alive,[1] but that the number is more likely between 47,000 and 78,000[5] The Central Chimpanzee only has large, robust populations where large amounts of forest are left undisturbed; smaller, isolated populations also remain.[4] According to the IUCN, decline in the central chimpanzee population is expected to continue for another 30 to 40 years.[2]

Major threats to central chimpanzee populations include Ebola hemorrhagic fever, poaching for bushmeat, and habitat destruction.[1][2][5] The IUCN attributes this to increasing human presence (agriculture, de-forestation, development) and political instability.[2]

Due to their close genetic relationship to humans, chimpanzees are vulnerable to viruses that afflict humans, such as Ebola, the common cold, influenza, pneumonia, whooping cough, tuberculosis, measles, yellow fever, HIV and may contract other parasitological diseases such as schistosomiasis, filariasis, giardiasis, and salmonellosis.[5]

Link with HIV-1

Two types of Human Immunodeficiency Virus (HIV) infect humans: HIV-1 and HIV-2. HIV-1 is the more virulent and easily transmitted, and is the source of the majority of HIV infections throughout the world; HIV-2 is largely confined to west Africa.[6] Both types originated in west and central Africa, jumping from primates to humans. HIV-1 has evolved from a Simian Immunodeficiency Virus (SIVcpz) found in the central chimpanzee.[7][8] Kinshasa, in the Democratic Republic of Congo, has the greatest genetic diversity of HIV-1 so far discovered, suggesting that the virus has been there longer than anywhere else. HIV-2 crossed species from a different strain of SIV, found in the Sooty Mangabey, monkeys in Guinea-Bissau.[6]

References

  1. ^ a b c World Wildlife Fund: Central chimpanzee. Retrieved 18 July 2008.
  2. ^ a b c d e f g h i Tutin, C.E.G., Baillie, J.E.M., Dupain, J., Gatti, S., Maisels, F., Stokes, E.J., Morgan, D.B. & Walsh, P.D. (2008). Pan troglodytes ssp. troglodytes. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Hof, Jutta; Sommer, Volker: Apes Like Us: Portraits of a Kinship, Edition Panorama , Mannheim 2010, ISBN 978-3-89823-435-1, p. 114.
  4. ^ a b WWF: Central chimpanzee – Population & Distribution. Retrieved 18 July 2008.
  5. ^ a b c d WWF: Chimpanzee facts and issues. Retrieved 18 July 2008.
  6. ^ a b Reeves JD, Doms RW (June 2002). "Human immunodeficiency virus type 2". J. Gen. Virol. 83 (Pt 6): 1253–65. doi:10.1099/vir.0.18253-0. PMID 12029140. http://vir.sgmjournals.org/cgi/pmidlookup?view=long&pmid=12029140.
  7. ^ Keele BF, Van Heuverswyn F, Li Y, et al. (July 2006). "Chimpanzee reservoirs of pandemic and nonpandemic HIV-1". Science 313 (5786): 523–6. doi:10.1126/science.1126531. PMC 2442710. PMID 16728595. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2442710/.
  8. ^ Gao F, Bailes E, Robertson DL, et al. (February 1999). "Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes". Nature 397 (6718): 436–41. doi:10.1038/17130. PMID 9989410.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!