Overview

Distribution

Range Description

Distributed from the Ethiopian Rift Valley, highlands east of the Rift, and southern Somalia in the north, through the eastern lowlands of Ethiopia, Kenya, Tanzania, Uganda, Zambia (east of the Luangwa Valley), Malawi, Mozambique, Zimbabwe, Botswana and South Africa (all provinces). This species has also been recorded from the islands of Pemba and Mafia, Tanzania, and the Manda Islands, Lamu Archipelago, of northern Kenya. Sympatric with Papio spp and Erythrocebus patas (T. Butynski and Y. de Jong pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is present in savanna, open woodland, and forest-grassland mosaic, especially close to rivers. It is an extremely adaptable and versatile species able to persist in secondary and/or highly fragmented vegetation, including cultivated areas, and sometimes found living in both rural and urban environments. A significant part of the range consists of Miombo woodland. Is generally absent from desert areas and deep forest within its range. Lives in multi-male and multi-female groups of up to 38 individuals; many unrelated males may be present in a group.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chlorocebus pygerythrus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGTTGACTCTTTTCAACAAACCACAAAGACATCGGAACTCTATACCTATTATTCGGTGCATGAGCTGGAATCACAGGCACAGCTCTAAGTCTTCTCATTCGAGCTGAACTAGGCCAACCCGGTAGTTTACTAGGTAGT---GACCATATCTATAATGTCATTGTAACAGCCCATGCATTTGTTATAATTTTCTTCATAGTTATGCCCATTATAATTGGAGGGTTCGGGAACTGACTAGTACCCCTGATAATTGGTGCTCCTGACATAGCATTCCCCCGTCTAAATAATATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTGCTGCTAATGGCATCAACTATAATCGAGGCTGGCGCCGGAACAGGTTGAACGGTATATCCCCCCTTAGCAGGAAACCTCTCTCACCCAGGGGCCTCCGTAGACTTAGTTATTTTCTCCCTCCACCTAGCAGGGATTTCCTCTATCCTAGGAGCTATCAACTTCATCACCACCATCATCAACATGAAGCCCCCCGCCATATCCCAGTATCAAACCCCATTGTTCGTCTGATCTGTCCTAATCACAGCAATCCTACTACTCCTCTCCCTACCAGTCTTAGCTGCCGGCATTACTATACTATTAACAGACCGCAACTTCAACACTACCTTCTTTGATCCTACTGGAGGGGGAGACCCTATCCTATACCAACATCTATTTTGATTCTTTGGCCACCCTGAGGTCTACATCCTTATTCTCCCTGGATTCGGAATAATCTCCCACATTGTAACTTACTACTCCGGGAAAAAAGAACCATTTGGGTATATAGGTATGACCTGGGCTATAATGTCAATCGGGTTCCTAGGATTCATTGTATGAGCCCACCACATATTTACAGTGGGCATAGATGTAGACACACGAGCCTACTTCACCTCCGCTACCATAATCATTGCTATTCCTACTGGAGTTAAAGTTTTCAGCTGACTTGCTACACTTCATGGAGGC---AAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chlorocebus pygerythrus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kingdon, J., Gippoliti, S., Butynski, T.M. & De Jong, Y.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Least Concern as this is a very widespread and abundant species with no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Often common and abundant. However, very patchily distributed over its extensive geographic range, probably due to its need to drink water daily (T. Butynski and Y. de Jong, pers comm.). Regarded as a pest species in cultivated areas in parts of its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats although it is classed as vermin in parts of its range and is actively persecuted (shot and hunted) by landowners in areas where it raids crops or interacts with humans. Vervets are found to be a source of bushmeat in some areas (e.g. Turkana District, Kenya; De Jong et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES and on Class B of the African Convention on the Conservation of Nature and Natural Resources. It is present in most protected areas within its range. Further taxonomic work is required to assess the validity of proposed subspecies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Vervet monkey

The vervet monkey (Chlorocebus pygerythrus), or simply vervet, is an Old World monkey of the family Cercopithecidae native to Africa. The term "vervet" is also used to refer to all the members of the genus Chlorocebus. The five distinct subspecies can be found mostly throughout Southern Africa, as well as some of the eastern countries. Vervets were introduced to Florida, Texas, Alabama, Louisiana, Arizona, California, Ascension Island, Cape Verde, Barbados, Saint Kitts, Bermuda, Bahamas, Cuba, Jamaica, Haiti, Dominican Republic, and Nevis.[3][4] These mostly vegetarian monkeys have black faces and grey body hair color, ranging in length from about 50 centimetres (20 in) for males to about 40 centimetres (16 in) for females.

In addition to very interesting behavioral research on natural populations, vervet monkeys serve as a nonhuman primate model for understanding genetic and social behaviors of humans. They have been noted for having human-like characteristics, such as hypertension, anxiety, and social and dependent alcohol use.[5] Vervets live in social groups ranging from 10 to 70 individuals, with males changing groups at the time of sexual maturity.[6] The most significant studies done on vervet monkeys involve their communication and alarm calls, specifically in regard to kin and group recognition and particular predator sightings.

Taxonomy[edit]

The vervet monkey was previously classified as Cercopithecus aethiops. The vervet and malbrouck have often been considered conspecific, or as subspecies of the widespread grivet.[7]

The five subspecies of vervet monkey are:[2]

Synonymy[edit]

C. p. pygerythrus, as Cercopithecus aethiops, was also formerly divided into four subspecies:

  • C. a. pygerythrus, from South Africa (Western Cape, Eastern Cape, Northern Cape and southern KwaZulu-Natal), and Lesotho; is said to have pale-coloured limbs and white hands and feet (though the hands are also said to be black with a scattering of greyish hairs),[11] and a greyish body colour with an olive sheen.[9]
  • C. a. cloetei, from northern KwaZulu-Natal, Swaziland and northern South Africa; is darker, with greyish-brown speckles and dark feet.[9]
  • C. a. marjoriae, from southern Botswana and the North West Province of South Africa; is pale in colour (light ash-grey).[9]
  • C. a. ngamiensis,[12] from north-eastern Botswana and the Okavango; has pale feet and a yellowish back[9] and the tail is darker (especially towards the tip) than in other southern vervets.[11]

These subspecies are no longer recognised and are synonymous with C. p. pygerythrus.

Physical description[edit]

The vervet monkey has a black face with a white fringe of hair, while the overall hair color is mostly grizzled-grey.[13] The adult male of all species has a pale blue scrotum and a red penis.[14] The species exhibits sexual dimorphism; the males are larger in weight and body length. Adult males weigh between 3.9 and 8.0 kg (8.6 and 17.6 lb), averaging 5.5 kg (12 lb), and have a body length between 420 and 600 mm (17 and 24 in), averaging 490 mm (19 in) from the top of the head to the base of the tail. Adult females weigh between 3.4 and 5.3 kg (7.5 and 11.7 lb) and average 4.1 kg (9.0 lb), and measure between 300 and 495 mm (11.8 and 19.5 in), averaging 426 mm (16.8 in).[11][15]

Behavior[edit]

Social behavior[edit]

A vervet monkey grooms another in Gaborone, Botswana

When males reach sexual maturity, they move to a neighboring group. Often, males will move with a brother or peer, presumably for protection against aggression by males and females of the resident group. Groups that had previously transferred males show significantly less aggression upon the arrival of another male. In almost every case, males migrate to adjacent groups. This obviously increases benefits in regard to distance traveled, but also reduces the amount of genetic variance, increasing the likelihood of inbreeding.[16]

Females remain in their groups throughout life. Separate dominance hierarchies are found for each sex. Male hierarchies are determined by age, tenure in the group, fighting abilities, and allies, while female hierarchies are dependent on maternal social status. A large proportion of interactions occur between individuals which are similarly ranked and closely related. Between unrelated individuals, there is female competition for grooming members of high-ranking families, presumably to gain more access to resources. These observations suggest individual recognition is possible and enables discrimination of genetic relatedness and social status. Interactions between different groups are variable, ranging from highly aggressive to friendly. Furthermore, individuals seem to be able to recognize cross-group vocalizations, and identify from and to which monkey each call is intended, even if the call is made by a subadult male which is likely to transfer groups. This suggests the members within a group are actively monitoring the activity of other groups, including the movement of individuals within a group.[17]

Within groups, aggression is directed primarily at individuals that are lower on the hierarchy. Once an individual is three years or older, it is considerably more likely to be involved in conflict. Conflict often arises when one group member shows aggression toward a close relative of another. Further, both males and females may redirect aggression towards individuals in which both had close relatives that were previously involved in a conflict. This suggests complex recognition not only of individuals, but also of associations between individuals. This does not suggest recognition of other's individual kinship bonds is possible, but rather that discrimination of social relationships does occur.[18]

Female and juvenile, Kruger Park, South Africa

Alarm calls and offspring recognition[edit]

A vervet baby monkey clinging to its mother

Vervet monkeys have four confirmed predators: leopards, eagles, pythons, and baboons. The sighting of each predator elicits an acoustically distinct alarm call.[19] In experimentation with unreliable signalers, individuals became habituated to incorrect calls from a specific individual. Though the response was lessened for a specific predator, if an unreliable individual gives an alarm call for a different predator, group members respond as if the alarm caller is, in fact, reliable. This suggests vervet monkeys are able to recognize and to respond to not only the individual calling, but also to the semantics of what the individual is communicating.[20]

Mothers can recognize their offspring by a scream alone. A juvenile scream will elicit a reaction from all mothers, yet the juvenile's own mother had a shorter latency in looking in the direction of the scream, as well as an increased duration in her look. Further, mothers have been observed to help their offspring in conflict, yet rarely aided other juveniles. Other mothers evidently can determine to which mother the offspring belongs. Individuals have been observed to look towards the mother whose offspring is creating the scream.[21]

Kin relationships[edit]

Siblings likely provide the prevailing social relationships during development. Within social groups, mother-offspring and sibling interactive units are distinct groups. The sibling interaction are heavily supportive and friendly, but do have some competition. Contests primarily involve postweaning resource allocation by the common mother. For example, siblings have conflict over grooming time allocated by their mother. Offspring are usually not born in extremely close proximity due to the interbirth period of the mother. This time can be reduced by use of an allomother. The clarity of the familial and sibships within a group may act as a form of alliance, which would come at relatively low cost in regards to grooming. Other alliances are shown through conflict with aggressive individuals that have acted against a closely related sibling.[22]

Vervet monkey female with a baby

Allomothering is the process when another individual besides the mother cares for an infant. In groups of vervet monkeys, infants are the source of a tremendous amount of attention. Days after an infant is born, every member of the group will inspect the infant at least once by touching or sniffing. While all group members participate in infant caretaking, juvenile females which cannot yet menstruate are responsible for the majority of allomothering. The benefit is mutual for the mother and allomother. Mothers that use allomothers are able to shorten their interbirth periods, the time between successive births. At the same time, allomothers gain experience in rearing infants, and had more success in raising their own offspring. Juvenile females discriminate in preference for the infant they choose to allomother, and will usually choose siblings or infants of high-ranking individuals. When a mother allows her juvenile daughter to become an allomother for a newborn sibling, the mother decreases her own investment in the infant, while increasing the chances of successful rearing of her immature daughter.[23]

Grandmothers and grandchildren share one-quarter of their genes, so they should be more likely to form affiliative relationships than unrelated members in a group. Not only do infants approach their grandmothers more often than unrelated members, but they also prefer their grandmothers compared to other adult female kin, not including their own mothers. Additional research has shown grandmothers show no preference over the sex of their grandchild. Interest in the grandchild spurred from the rank of the grandmother within a group. Higher-ranking grandmothers showed more interest in caring for their grandchildren when compared to low-ranking grandmothers. The presence of grandmothers has been associated with a decrease in mortality of infants.[24]

Spite[edit]

Spiteful actions are extremely rare in the animal kingdom. Often, there is an indirect benefit to the individual acting 'spiteful' or to a close relative of that individual. Vervet monkeys have been observed to destroy a competitor's food source rather than consume or steal it themselves. While energy is being lost on destroying the food, a competitive advantage is given to the individual due to an increase in competitive gain. This would be pertinent for a male which could be displaced within his group to immigrating males.[25]

Reproduction[edit]

Female vervets do not have external signs indicating a menstruation period, thus there are not elaborate social behaviors involving reproduction. Typically, a female can give birth at any time during the year after a gestation period of about 165 days. Usually. only one infant born at a time, though twins can occur rarely. A normal infant weighs 300–400 g.[11]

Ecology[edit]

Diet[edit]

Young vervet monkey in South Africa eating fruits of Harpephyllum caffrum

The vervet monkey eats a primarily vegetarian diet, living mostly on wild fruits, flowers, leaves, seeds, and seed pods. In agricultural areas, vervets become problem animals, as they will raid bean crops, peas, young tobacco plants, vegetables, fruit, and various grain crops. Carnivorous aspects of their diet include grasshoppers and termites. Raids of cattle egrets and weaver bird nests have been observed where the vervets will eat the eggs and chicks.[11]

A list of some natural food plants and part of the plant eaten, in South Africa:[11][26]

Distribution and habitat[edit]

The vervet monkey ranges throughout much of Southern and East Africa, being found from Ethiopia, Somalia and extreme southern South Sudan, to South Africa. It is not found west of the East African Rift or the Luangwa River,[1] where it is replaced by the closely related malbrouck (C. cynosuros). The vervet monkey inhabits savanna, riverine woodland, coastal forest and mountains up to 4000 m (13,100 ft). They are adaptable and able to persist in secondary and/or highly fragmented vegetation, including cultivated areas, and sometimes are found living in both rural and urban environments.[2] Annual home range size has been observed to be as high as 176 ha with an average population density of 54.68 animals/km².

Introduced vervet monkeys are naturalized in Ascension Island, Cape Verde, Bermuda, Barbados, Bahamas, Cuba, Jamaica, Haiti, Dominican Republic, and Saint Kitts and Nevis. Dania Beach, Florida is home to about 20 introduced vervets.[27]

Relationship with humans[edit]

An infant vervet monkey, South Africa

In spite of low predator populations in many areas, human development has encroached on wild territories, and this species is killed by electricity pylons, vehicles, dogs, pellet guns, poison, and bullets, and is trapped for traditional medicine, bush meat, and for biomedical research.[28] The vervet monkey has a complex and fragile social system, and persecution of the monkeys is thought to have affected troop structures and diminishing numbers.

Its status according to the IUCN is "least concern".

This species was known in ancient Egypt including the Red Sea Mountains and the Nile Valley.[29] From fresco artworks found in Akrotiri on the Mediterranean island of Santorini there is evidence that the vervet monkey was known to the inhabitants of this settlement around 2000 BC; this fact is most noted for evidence of early contact between Egypt and Akrotiri.[30]

Gallery[edit]

References[edit]

  1. ^ a b Groves, C. P. (2005). "Chlorocebus pygerythrus". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 159. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b c Kingdon, J., Gippoliti, S., Butynski, T.M. & De Jong, Y. (2008). "Chlorocebus pygerythrus". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. Retrieved 11 April 2010. 
  3. ^ https://www.triposo.com/section/Vervet_monkey
  4. ^ http://www.zmescience.com/tag/vervet-monkey/
  5. ^ Palmour, R.; Mulligan, J.; Howbert, J. Jeffry; Ervin, F. (1997). "Of Monkeys and Men: Vervets and the Genetics of Human-Like Behaviors". Am. J. Hum. Genet. 61 (3): 481–488. doi:10.1086/515526. 
  6. ^ Pasternak, Graham; Brown, Leslie; Kienzle, Stefan; Fuller, Andrea; Barrett, Louise; Henzi, Peter (2013). "Population ecology of vervet monkey in a high latitude, semi-arid riparian woodland". Koedoe 55 (1). doi:10.4102/koedoe.v55i1.1078. Retrieved 4 June 2014. 
  7. ^ Kingdon, J. (1997). The Kingdom Guide to African Mammals. Academic Press Limited, London. ISBN 0-12-408355-2. 
  8. ^ a b c Biodiversity occurrence data provided by: Field Museum of Natural History, Museum of Vertebrate Zoology, University of Washington Burke Museum, and University of Turku (Accessed through GBIF Data Portal, www.gbif.net, 2010-06-18)
  9. ^ a b c d e f Cillie', G.E.B. (1992). Pocket Guide to Southern African Mammals. ISBN 0-627-01686-3.
  10. ^ (Isbell & Enstam under review)
  11. ^ a b c d e f g Skinner, J.D. (1990). The Mammals of the Southern African Subregion (New Edition). ISBN 0-86979-802-2
  12. ^ Meester, J. A. J., I. L. Rautenbach, N. J. Dippenaar, and C. M. Baker. 1986. Classification of southern African mammals. Transvaal Museum Monographs 5:1–359
  13. ^ Stuart C. and Stuart T. (1997). Field Guide to the Larger Mammals of Africa. ISBN 1-86825-757-6
  14. ^ Fedigan L, Fedigan LM. (1988). Cercopithecus aethiops: a review of field studies. Cambridge (UK): Cambridge University Press. pp. 389–411. 
  15. ^ Napier, P.H. (editor) (1981). "Part II: Family Cercopithecidae, Subfamily Cercopithecinae". Catalogue of primates in the British Museum (Natural History) and elsewhere in the British Isles. London: British Museum (Natural History). p. 203. 
  16. ^ Cheney, D. L.; R.M. Seyfarth (September 1983). "Nonrandom Dispersal in Free-Ranging Vervet Monkeys: Social and Genetic Consequences". The American Naturalist 122 (3): 392–412. doi:10.1086/284142. JSTOR 2461023. 
  17. ^ Cheney, D. L.; R.M. Seyfarth (1982). "Recognition of Individuals within and between Groups of Free-Ranging Vervet Monkeys". American Zoologist 22 (3): 519–529. doi:10.1093/icb/22.3.519. JSTOR 3882575. 
  18. ^ Cheney, D. L.; R.M. Seyfarth (1986). "The Recognition of Social Alliances by Vervet Monkeys". Animal Behaviour 34 (6): 1722–1731. doi:10.1016/S0003-3472(86)80259-7. 
  19. ^ Seyfarth, R.M.; D.L Cheney and Peter Marler (1980). "Vervet Monkey Alarm Calls: Semantic communication in a Free-Ranging Primate". Animal Behaviour 28 (4): 1070–1094. doi:10.1016/S0003-3472(80)80097-2. 
  20. ^ Cheney, D. L.; R.M. Seyfarth (1988). "Assessment of meaning and the detection of unreliable signals by vervet monkeys". Animal Behaviour 36 (2): 477–486. doi:10.1016/S0003-3472(88)80018-6. 
  21. ^ Cheney, D. L.; R.M. Seyfarth (1980). "Vocal Recognition in Free-Ranging Vervet Monkeys". Animal Behaviour 28 (2): 362–367. doi:10.1016/S0003-3472(80)80044-3. 
  22. ^ Lee, P.C. (1987). "Sibships:Cooperation and Competition Among Immature Vervet Monkeys". Primates 28 (1): 47–59. doi:10.1007/BF02382182. 
  23. ^ Fairbanks, L.A. (1990). "Reciprocal benefits of allomothering for female vervet monkeys". Animal Behaviour 40 (3): 553–562. doi:10.1016/S0003-3472(05)80536-6. 
  24. ^ Fairbanks, L.A. (1988). "Vervet Monkey Grandmothers: Interactions with Infant Grandoffspring". International Journal of Primatology 9 (5): 426–441. doi:10.1007/bf02736218. 
  25. ^ Horrocks, J.; W. Hunte (1981). "'Spite'; a constraint on optimal foraging in the vervet monkey Cercopithecus aethiops sabaeus in Barbados". American Zoology 21: 939. 
  26. ^ Pooley, E. (1993). The Complete Field Guide to Trees of Natal, Zululand and Transkei. ISBN 0-620-17697-0.
  27. ^ Freimer, N.; Dewar, K.; Kaplan; Fairbanks, L. "The Importance of the Vervet (African Green Monkey) as a Biomedical Model" (pdf). National Human Genome Research Institute. Retrieved 2011-01-29. 
  28. ^ Foggo, Daniel (2008-07-06). "Germ warfare fear over African monkeys taken to Iran". The Times (London). Retrieved 2010-03-27. 
  29. ^ Moeyersons, J., Vermeersch, P. M., Beeckman, H. & Van Peer, P. (1999). "Holocene environmental changes in the Gebel Umm Hammad, Eastern Desert, Egypt: Dry cave deposits and their palaeoenvironmental significance during the last 115 ka, Sodmein Cave, Red Sea Mountains, Egypt". Geomorphology 26 (4): 297–312. doi:10.1016/S0169-555X(98)00067-1. 
  30. ^ Michael Hogan, C. (2007-12-13). "Akrotiri". Modern Antiquarian. Retrieved 2008-07-13. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Vervet monkey foundation

Registered and established in 1993, The Vervet Monkey Foundation (VMF) is a 23-hectare not-for-profit (#020 694 NPO)[1] centre for rehabilitation, education and sanctuary for Vervet Monkeys, near the town of Tzaneen, South Africa.[2] It is situated approximately 80 miles south of The Tropic of Capricorn. It is a member of the Pan-African Sanctuary Alliance (PASA).[3] The foundation relies heavily on volunteer workers primarily from western countries to assist in the day to day running and care duties of the foundation.

Coordinates: 23°51′11″S 30°20′17″E / 23.85306°S 30.33806°E / -23.85306; 30.33806

Hellen.jpg

Contents

History

In 1989 the first monkey, "Regus" was found orphaned, just a few hours old. He was placed in the care of Arthur Hunt and Dave Du Toit. After various legal battles, Arthur and Dave were permitted to keep Regus, and co-founded the Vervet Monkey Foundation. They began to research the possibility of rehabilitating Vervet Monkeys and to develop a rehabilitation programme and sanctuary where Vervet Monkeys in need of help would be humanely treated.[4] The foundation has now taken over 600 monkeys into their care, including several from Medunsa University in 2002.[5] and relies heavily on donations, sponsorship and volunteer workers from abroad.[6]

Aims

  • A facility to research the life style and environment of this species.
  • A program to rehabilitate orphaned and injured primates.
  • A program to research the claims of damage and problems caused by Vervet Monkeys and offer possible solutions for co-existence.
  • An education program to inform the public of the role that the Vervet Monkey plays in the eco system.
  • A sanctuary for primates unfortunate enough to be unreleasable but, manageable enough to be used for educational purposes.

Rehabilitation

The Vervet Monkey Foundation has, over many years, developed a new approach to the rehabilitation of orphaned Vervet Monkeys.

In 1998 the Vervet Monkey Foundation announced a rehabilitation programme that incorporated the use of large electrified enclosures that are natural, and by using introduction enclosures, formed within this natural system, large viable troops, that would be re-introduce into protected vervet forest reserves.

The rehabilitation centre is designed to handle orphaned Vervet Monkeys of all ages and more specifically designed to cope with large numbers of babies that become orphaned each year. Hundreds of babies have now been rescued and rehabilitated within a natural environment.[7]

Volunteerism

Volunteers are accepted from all over the world, and are provided accommodation in wooden cabins. The duties that volunteers have to undertake are varied and change during the year and all volunteers are tasked to do a variety of chores, such as, collecting & cleaning baby bottles, making baby formula, cleaning and preparing bowls of fruit & vegetables for the monkeys, washing monkey blankets, monitoring monkeys in enclosures, working in the sickbay area, occasional cooking, washing food bowls and collecting seed pods for monkeys.

In addition, volunteers are also tasked with the building of new enclosures for monkeys. Construction involves building, painting, sanding, welding, fence-building, knot-tying, firebreaks & invader species eradication. Sometimes volunteers are required to cut grass & prepare thatch bundles for construction, or to letter & paint signs for enclosures. [8]

Vervet Forest

Launched in 2004 by the VMF, The Vervet Forest campaign aims to protect, reclaim and restore degraded or damaged habitat through the acquisition of land for the release of rehabilitated vervet monkey troops.

By creating a rehabilitation model to incorporate the Vervet Monkey's proficiency as a seed dispersal expert,[9] the monkeys will germinate and work in harmony with over 30 indigenous tree species in South Africa.

Through supporting nature's natural process of vegetation creation, both people and monkey will work together to reclaim, transform and protect degraded habitat, restoring it back into a healthy state able to support a multitude of wildlife. [10]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!