Molecular Biology and Genetics

Molecular Biology

Barcode data: Equus asinus somalicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAAGACATCGGCACTCTGTATCTCCTATTCGGCGCTTGAGCTGGAATAGTAGGAACCGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGTCAACCTGGGACCCTACTGGGAGATGATCAGATCTACAATGTTATTGTAACCGCCCATGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATGATCGGAGGATTTGGGAACTGATTAGTTCCCTTAATAATTGGAGCACCCGATATAGCCTTTCCCCGAATAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTTGCTTCCTCAATAATTGAAGCAGGCGCTGGAACAGGCTGAACCGTATATCCTCCCCTAGCTGGAAACCTAGCGCACGCAGGGGCTTCTGTTGACTTAACCATCTTCTCTCTTCACCTAGCTGGTGTATCTTCAATTTTAGGTGCCATCAATTTCATTACCACAATCATCAACATAAAACCACCAGCCCTGTCCCAGTATCAAACTCCTCTATTCGTTTGATCCGTCCTCATTACGGCAGTACTCCTTCTCCTAGCTCTTCCAGTCCTAGCAGCAGGTATTACTATGCTTCTCACAGACCGTAACTTAAACACCACCTTCTTCGACCCTGCAGGGGGAGGGGATCCAATCCTTTACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTCTACATTCTCATTCTGCCAGGCTTTGGTATAATCTCACACATCGTCACATATTATTCAGGTAAAAAAGAACCTTTCGGTTACATGGGCATAGTATGAGCTATAATATCCATTGGCTTTCTAGGCTTCATCGTATGAGCTCACCACATGTTTACAGTAGGTATAGACGTCGATACACGAGCATATTTCACATCAGCTACCATAATCATCGCCATCCCTACCGGTGTAAAAGTATTCAGCTGACTAGCTACCCTGCACGGAGGAAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGTTTCATCTTCTTATTCACAGTAGGAGGTCTAACAGGAATCGTCTTGGCCAACTCATCCCTAGATATTGTTCTCCACGACACTTATTATGTAGTAGCACATTTCCACTACGTCCTATCCATAGGAGCAGTCTTCGCCATTATGGGGGGATTTGTTCACTGATTCCCTCTATTCTCGGGATATACACTCAATCAAACCTGAGCAAAAATCCACTTTACAATTATATTCGTAGGGGTCAATATAACTTTCTTCCCACAACACTTCCTTGGCCTCTCAGGAATACCACGACGCTATTCTGACTACCCAGACGCGTACACAACATGAAACACTATCTCATCCATAGGATCTTTTATCTCACTCACAGCAGTAATACTAATAGTCTTCATAATTTGAGAAGCATTCGCATCCAAACGAGAAGTGTCTACAGTAGAATTAACCTCAACTAACCTAGAATGACTACACGGATGCCCCCCGCCATACCATACATTTGAAGAACCCGCCTACGTAAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Equus asinus somalicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Somali wild ass

The Somali wild ass (Equus africanus somaliensis)[3] is a subspecies of the African wild ass. It is found in the Southern Red Sea region of Eritrea, the Afar Region of Ethiopia, and still in Somalia. The legs of the Somali wild ass are horizontally striped with black, resembling those of a zebra.

Contents

Current distribution and habitat

Two Somali wild ass in a UK zoo

There are likely less than 1000 animals (or even 700) in the wild[4] and the IUCN Red List of endangered species described it as "critically endangered". This means they face an extremely high risk of extinction in the wild.

A few hundred animals live in Ethiopia as well as in Eritrea. There might be still some in Somalia, most likely in the stable Somaliland region. Wars and food competition with domesticated animals and the local human population, as well as decreasing food and water sources diminished wild population – extremely in the past few years.[5]

Captivity

Global population

As of 2011, there are about 200 individuals in captivity around the globe [5] living in 34 zoos, as well as three animals in Hai-Bar, Israel (as of 2009).[6] The international studbook is managed by Tierpark Berlin.[7]

Zoo Basel

Somali Wild Ass at Zoo Basel

The leading zoo for breeding this rare ass is Zoo Basel, Switzerland. Its breeding program manages the European studbook for the Somali wild ass and coordinates the European Endangered Species Programme (EEP)[8] - as well as the global species committee of the Somali Wild Ass since 2004.[6]

Basel started having Somali wild asses in 1970 and had its first birth in 1972. Since then, 11 stallions and 24 females (as of 2009) were born and survived childhood[9] Today, all Somali wild donkeys in captivity are related to the original group at Zoo Basel.[10]

As of January 18, 2012, there are four Somali wild donkeys in Basel: The stallion "Gigolo" (3) and three females (among them "Yogala"-14)"[11]

Domestication

Domestic donkeys found in Italy are typically descended from the Somali wild ass, as opposed to those from other European countries where domesticated stock are usually descended from the Nubian wild ass.[12]

Conservation

A conservation project (mainly supported by Zoo Basel) in the East-African country of Eritrea counts 47 Somali wild asses living in the mountains between the Buri Peninsula and the Dalool ditch.[13]

A protected population of the Somali wild ass exists in the Yotvata Hai-Bar Nature Reserve in Israel, to the north of Eilat. This reserve was established in 1968 with the view to bolster populations of endangered desert species.

References

  1. ^ (German) Noack Th. (1884). "Neues aus der Tierhandlung von Karl Hagenbeck, sowie aus dem Zoologischen Garten in Hamburg". Der Zoologische Garten 25: 100-115.
  2. ^ Sclater P. L. (1884). "On some mammals from Somali-land". Proceedings of the Scientific Meetings of the Zoological Society of London 1884: 538-542, pls. 49-50.
  3. ^ a b Groves C. P. & Smeenk C. (June 2007). "The nomenclature of the African wild ass". Zoologische Mededelingen 81(1). HTM, PDF
  4. ^ http://www.stlzoo.org/pressroom/zoointhenews/somaliwildassproblem.htm
  5. ^ a b Seltene Schönheit. (German) Zoo Basel, retrieved 2010-12-25
  6. ^ a b (German) Förderprojekte der Werner Stamm Stiftungn . Werner Stamm Stiftung, retrieved 2011-11-14
  7. ^ (German) Somali-Wildesel. zoodirektoren.de, retrieved 2011-11-14
  8. ^ http://www.zoobasel.ch/aktuell/detail.php?NEWSID=187&PHPSESSID=34277fba68d5857ecdb43ae645c9831c%7CZoo Basel|INDIAN RHINO VISION (IRV) 2020
  9. ^ http://www.zoobasel.ch/aktuell/detail.php?NEWSID=140&PHPSESSID=8be9b081e26b26503b123f9ea7cd8ff4
  10. ^ http://www.zoodirektoren.de/magazin/drucken.php?artikel=1525&type=
  11. ^ (German) Tanz der Somali-Wildesel. Zoo Basel, retrieved 2012-2-24
  12. ^ "Pompeii Horse Is in Fact an Ass". BBC. 3 November 2010. http://news.bbc.co.uk/local/cambridgeshire/hi/people_and_places/history/newsid_9150000/9150180.stm.
  13. ^ http://zoobasel.ch/wissen/naturschutz/index.php?NSPID=6&pnl=1_1
  • Moehlman, P. D. (ed). 2002. Equids: Zebras, Asses, and Horses: Status Survey and Conservation Action Plan. Gland, Switzerland: IUCN/SCC Equid Specialist Group
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!