Overview

Brief Summary

The East African oryxes have traditionally been treated as a single species, Oryx beisa (and often even considered conspecific with the Gemsbok, O. gazella, of southwestern Africa). According to Groves (2011), however, although they are very similar in appearance they are best treated as three distinct species: Beisa Oryx (O. beisa), found in northern and central Somalia and the Ogaden region of Ethiopia north to Berbera, west to Eritrea, and south into the Awash Valley; Oryx (O. gallarum), found in northern Kenya and northeastern Uganda and extending into Somalia and southeastern Ethiopia; and Fringe-eared Oryx (O. callotis), found in southeastern Kenya and northeastern Tanzania.

The Beisa Oryx is a large antelope with a thick neck, long face, and long straight horns. It is found mainly in desert country, arid grassland, and scrub. It typically occurs in small herds of 7 to 30 individuals. It is reported to be common in the Awash National Park, but declining elsewhere due to hunting and overgrazing. Population declines likely approached 25% over the past three generations.

(Kingdon 1997; Groves 2011)

  • Groves, C.P. 2011. Genus Oryx. Pp. 688-692 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species formerly occurred widely in the semi-arid and arid bushland and grasslands of North-East Africa, from north-east Sudan throughout arid areas of Eritrea, Ethiopia, north-east Uganda and Kenya to Djibouti, Somalia and north-east Tanzania (Wacher and Kingdon in press). Their distribution has declined markedly in numbers and distribution, especially at the margins of its range, e.g., Uganda and Somalia, but still occur quite widely in areas of Ethiopia, northern and eastern Kenya and north-eastern Tanzania where human and livestock densities are low (East 1999).

There is no recent confirmation of Beisa Oryx occurrence in Eritrea, where its status is uncertain. Likewise, the failure to locate any oryx during a 1995 aerial survey of Bokora Corridor, Matheniko and adjoining areas of Karamoja suggests that it has either disappeared completely from Uganda or at best survives in very small numbers (East 1999).

Fringe-eared Oryx are distributed entirely south of the Tana River in eastern Kenya and north-east Tanzania, with a major centre of distribution in Tsavo (East) and the Galana Ranch region (Cobb 1976), spreading west and south to Mkomazi, Amboseli and sporadically appearing in Serengeti (Wacher and Kingdon in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs widely in the semi-arid and arid bushland and grasslands of North-East Africa. The condition of grazing and state of the soil influence seasonal movements (Wacher and Kingdon in press). They occur to altitudes of 1,700 m in Ethiopia (Yalden et al. 1996). Both subspecies eat a wide range of grass species and growth stages, taking more browse during the dry season (Wacher and Kingdon in press). Drinks regularly when water available, but can get by on water-storing melons, roots, bulbs, and tubers, for which it digs assiduously.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oryx beisa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGATATCGGTACCTTGTACCTCCTATTCGGTGCTTGAGCTGGCATAGTGGGAACCGCCCTAAGCTTACTAATTCGCGCTGAATTAGGTCAACCTGGGACTTTACTTGGAGATGATCAAATCTACAACGTAGTCGTAACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATACCTATTATGATTGGAGGGTTTGGCAACTGACTAGTCCCTCTAATAATTGGAGCCCCCGACATAGCATTCCCTCGAATAAATAATATAAGCTTTTGACTGCTTCCTCCTTCTTTTCTACTACTCCTAGCATCTTCTATAGTTGAAGCTGGAGCCGGAACAGGTTGAACCGTATATCCCCCTCTAGCTGGCAACCTAGCTCATGCAGGAGCCTCAGTAGATCTCACTATTTTCTCTTTACACTTAGCAGGTGTTTCCTCAATTTTAGGAGCCATCAATTTTATCACAACAATCATTAACATAAAACCCCCTGCAATAACACAATATCAAACTCCCTTGTTTGTATGATCTGTGCTAATTACTGCTGTTTTACTTCTCCTTTCACTCCCTGTATTAGCAGCCGGCATTACAATACTATTAACAGATCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGAGGGGGAGACCCTATCTTATATCAACATCTGTTCTGATTCTTTGGTCACCCTGAAGTATATATCCTTATTTTACCTGGATTCGGAATAATTTCTCACATTGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGATATATAGGAATAGTGTGAGCTATAATATCAATCGGATTCCTGGGGTTCATCGTATGAGCTCATCATATATTCACAGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCTACCATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTTAGCTGACTAGCAACACTCCATGGAGGTAATATCAAATGATCTCCTGCTATAATATGGGCCCTAGGCTTCATTTTCCTCTTCACAGTTGGAGGCCTAACTGGAATTGTCCTAGCCAACTCTTCTCTTGACATTGTTCTTCATGATACATATTATGTAGTCGCACATTTTCACTATGTCCTATCAATAGGAGCTGTATTCGCTATTATAGGAGGATTTGTACATTGATTTCCACTATTCTCAGGCTACACTCTAAACATAACATGAGCCAAAATCCATTTCGCAATTATGTTTGTAGGCGTAAACATAACATTCTTCCCACAACACTTCTTAGGCTTGTCTGGCATGCCACGACGATATTCTGATTATCCAGACGCATACACGATGTGAAATACCATCTCATCTATAGGCTCATTTATTTCACTAACAGCGGTGATACTAATAATTTTTATTATCTGAGAGGCATTTGCATCCAAACGAGAAGTCTCGACCGTAGACCTAACTACAACTAACCTAGAGTGACTAAACGGATGTCCCCCACCATACCACACATTTGAAGAACCCGCATATGTAAACCTAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oryx beisa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
Listed as Near Threatened as numbers have been estimated at ca. 67,000 and populations trends are declining apart from in a few protected areas. It had already declined heavily around the margins of its range. Threats from hunting and overgrazing are continuing and it is predicted that the overall level of decline will reach at least 25% over the last 3 generations (21-24 years), thus approaching the threshold for Vulnerable under criterion A2.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population estimates are available from aerial surveys of large parts of the species’ range. Summation of these estimates suggests total populations of about 25,000 Beisa and 8,000 Fringe-eared, but this makes no allowance for unknown levels of undercounting bias and areas for which no estimates of numbers are available. Citing various authors East (1999) indicates that population densities estimated from aerial surveys are typically low, e.g., 0.05-0.10/km² in areas such as the Awash Valley and Tsavo and 0.15-0.20/km² in areas such as Omo-Mago-Murule-Chew Bahir, Mkomazi and Tarangire.

East (1999), correcting for undercounting bias, gives estimated total populations of about 50,000 Beisa Oryx and 17,000 Fringe-eared Oryx (East 1999). Population trends are probably gradually downward over most of the species’ current range, with exceptions in areas such as Sibiloi and Laikipia (Beisa Oryx) and Kajiado, Tarangire and Mkomazi (Fringe-eared).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Poaching (for meat and hides) and encroachment by settlement and livestock remain the major threats to this species, especially since the majority of the population remains outside protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Most remaining populations of Beisa Oryx occur outside protected areas (with only 17% of the population in Pas). The largest populations occur in the Awash N.P. in the Awash Valley and Omo-Mago-Muruie-Chew Bahir (Ethiopia) and Sibiloi National Park and the unprotected northern rangelands (Kenya).

About 60% of Fringe-eared Oryx are in protected areas, particularly in Tsavo, Kajiado and Kilifi (Kenya) and Tarangire and Mkomazi (Tanzania).

More effective protection and management of the remaining populations in areas where the species still occurs in substantial numbers but its populations are in decline, such as the Awash Valley, Omo-Mago-Chew Bahir, northern Kenya and Tsavo, would greatly enhance the long-term survival prospects of this species (East 1999).

Populations of Beisa Oryx are maintained in captivity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

East African oryx

The East African oryx (Oryx beisa), also known as the beisa[2] is a species of antelope from East Africa. It has two subspecies: the common beisa oryx (Oryx beisa beisa) found in steppe and semidesert throughout the Horn of Africa and north of the Tana River, and the fringe-eared oryx (Oryx beisa callotis) south of the Tana River in southern Kenya and parts of Tanzania. In the past, some taxonomists considered it a subspecies of the gemsbok (Oryx gazella), but they are genetically distinct; the diploid chromosome count is 56 for the beisa and 58 for the gemsbok.[citation needed]

Common beisa oryx (Oryx beisa beisa)
Fringe-eared oryx (O. b. callotis)

The East African oryx stands just over a metre at the shoulder and weighs around 175 lb (Bad rounding here79 kg). It has a grey coat with a white underside, separated from the grey by a stripe of black, with black stripes where the head attaches to the neck, along the nose, and from the eye to the mouth and on the forehead. The mane is small and chestnut-coloured; the ringed horns are thin and straight. They are found on both sexes and typically measure 75–80 cm (30–31 in). Comparably, the gemsbok has an entirely black tail, a black patch at the base of the tail, and more black on the legs (including a patch on the hindlegs) and lower flanks. The smaller Arabian oryx is overall whiter with largely dark legs.

East African oryx live in semidesert and steppes, where they eat grasses, leaves, fruit and buds. They are able to store water by raising their body temperatures (so as to avoid perspiration). They gather in herds of five to 40 animals, often with females moving at the front and a large male guarding from the rear. Some older males are solitary. Radio tracking studies show the solitary males are often accompanied for brief periods by breeding-condition females, so it is probable they are executing a strategy to maximise their chances of reproduction.

Fringe-eared oryx (O. b. callotis) in Tsavo West National Park
Common beisa oryx (O. b. beisa) in Central Kenya

References

  1. ^ IUCN SSC Antelope Specialist Group (2008). Oryx beisa. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 13 November 2008.Database entry includes a brief justification of why this species is of Near Threatened.
  2. ^ Grubb, P. (16 November 2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!