Overview

Distribution

Range Description

Mazama nemorivaga occurs in Brazil, French Guiana, Suriname, Guyana, Venezuela, Colombia, Isla San José (Panamá), Ecuador, Peru, and probably in Bolivia. In Brazil, this species occupies the Amazon forest and transitional areas in its border, where it may be in sympatry with M. gouazoubira as reported by Rossi (2000) for the states of Mato Grosso and Maranhão. It is probably present everywhere in the territory of French Guiana, Suriname, and Guyana, but in Venezuela it has a disjunct distribution that includes the evergreen and semidecidual forests south of Río Orinoco in the states of Amazonas and Bolívar, plus the decidual forests and xeric shrublands of the coastal region in the states of Aragua, Carabobo, Falcón, Lara, and Zulia (Bisbal 1991). In Colombia, Alberico et al. (2000) reported the occurrence of the Amazonian brown brocket deer in the Amazon and Caribbean regions in the states of Amazonas, Caquetá, Bolívar, Cesar, and Cundinamarca, from 0 to 500 meters high. Additional information gathered from the literature points the presence of this species also in the states of Antioquia, La Guajira, Magdalena, and Meta (Allen 1904; Barriga-Bonilla 1966; Lydekker 1915; Medellín et al. 1998; Osgood 1912). M. nemorivaga does not reach Central America except for the Isla San José in the Archipiélago de las Perlas, Golfo de Panamá, Panamá (Kellogg 1946; Medellín et al. 1998). In Ecuador, it can be found in the entire Amazon region (Tirira 2001). There is no published data regarding the distribution of M. nemorivaga in Peru, but according to J. Barrio (pers. comm.) this species occurs all over the Amazon region (except for some flooded areas), and reaches sites up to 1500 meters high (J. Barrio pers. comm.). It probably occurs in northern Bolivia, although Anderson (1997) had only reported the presence of M. g. gouazoubira in this part of the country.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Most of the localities with records of M. nemorivaga are inside the tropical and subtropical broadleaf moist forests biome of Olson et al. (2001), and are related to the Amazon region. From a total of 114 records, 10 are inside the tropical and subtropical broadleaf dry forest biome, and 7 are inside the desert and xeric scrubland biome. The majority of the localities associated with dry or xeric habitats are those referred to M. gouzoubira cita by Bisbal (1991). The taxonomic status of Mazama cita Osgood, 1912 still needs to be thoroughly evaluated.

According to the absence or presence of flooding, the Amazonian rain forests are broadly classified into respectively non-flooded (tierra/terra firme) and seasonally flooded (várzea) forests. Mazama nemorivaga inhabits the non-flooded forests and is rare or absent in the seasonally flooded forests. For example, it does not occur in the Pacaya-Samiria National Reserve in Peru, which covers an area of over 2 million hectares of seasonally flooded várzea forests. However, it is found in the adjacent inter-fluvial upland forests of the Yavari valley (Bodmer 2003).

Reproduction biology of the Amazonian brown brocket deer has been studied by Hurtado-Gonzales (2000) in the northeast Peruvian Amazon. Breeding appeared to be year round, and occurred from January to March, July to October, and December. Births occurred in January, March, April, and from July through October. No twinning was observed and the pregnancy rate was 0.50 pregnant females/total numbers of females. Most of the pregnant females were adults between 1 and 2 years old. In northeast Bolívar, Venezuela, Bisbal (1994) found pregnant females in December, January, and April. Births occurred in July, August, and November, apparently associated with the rainy season.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mazama nemorivaga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACCAATCATAAAGATATTGGTACCTTATATTTACTATTTGGTGCTTGAGCAGGCATAGTAGGAACTGCCCTAAGCCTACTAATTCGTGCTGAATTGGGCCAACCCGGCACTTTACTCGGAGATGATCAAATTTATAATGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTTGGTAATTGACTTGTCCCATTAATAATTGGTGCCCCAGATATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTTCCCCCTTCCTTTTTACTTCTTCTAGCATCATCTATAGTTGAAGCTGGAGCAGGAACAGGTTGAACTGTTTATCCCCCTTTAGCTGGCAATCTAGCTCATGCAGGAGCTTCAGTTGACTTAACTATCTTTTCTCTACACTTGGCAGGCATTTCCTCAATTTTAGGGGCTATTAACTTTATTACAACAATTATCAACATAAAACCCCCTGCCATATCACAATATCAAACCCCTTTGTTTGTATGATCCGTACTAATTACTGCAGTACTATTACTTCTCTCACTCCCTGTACTAGCAGCCGGAATTACAATATTATTAACAGACCGAAATCTAAATACAACTTTCTTTGATCCAGCAGGGGGCGGAGACCCTATTCTATATCAACACTTGTTCTGATTTTTTGGACACCCTGAAGTATATATTCTTATTTTACCTGGGTTTGGTATAATTTCTCATATCGTAACCTATTATTCTGGTAAAAAAGAACCATTCGGGTATATGGGTATAGTATGAGCTATAATATCAATTGGATTTTTAGGATTTATTGTATGAGCCCACCACATATTTACAGTCGGAATAGACGTTGACACACGAGCCTACTTTACATCAGCTACTATAATTATTGCTATCCCAACCGGAGTAAAAGTGTTTAGTTGATTAGCAACACTTCATGGAGGTAACATTAAATGATCACCTGCCATAATATGAGCTCTAGGTTTTATTTTTCTTTTCACAGTTGGAGGACTAACTGGGATTGTTCTTGCCAACTCTTCTCTTGACATTGTTCTCCACGACACATATTACGTAGTTGCACATTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGGAGGATTTGTCCACTGATTTCCACTATTTTCAGGATATACTCTTAATGATACATGAGCTAAAATTCACTTTGTAATTATATTTGTAGGCGTAAATATAACCTTTTTTCCACAACATTTCCTAGGACTATCTGGAATACCACGACGTTACTCTGACTACCCAGACGCATACACAATGTGAAATACAATTTCTTCTATAGGCTCATTTATTTCCCTAACAGCAGTTATACTAATAATTTTTATTATCTGAGAAGCATTTGCATCTAAGCGAGAAGTCTCAACCGTAGAATTAACAACAACAAATTTAGAATGACTAAACGGATGTCCTCCACCATATCATACATTTGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mazama nemorivaga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Rossi, R.V. & Duarte, J.M.B

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Lest Concern in light of its wide distribution and occurrence in many protected areas. Mazama nemorivaga has a large geographic distribution mostly associated to the Amazon basin forests. Although this species is threatened by loss of habitat and local hunting (mainly for subsistence), it occurs in several protected areas throughout its range. Besides, several studies have shown that over hunting is not a real threat to this deer (at least in Suriname and northeastern Peru), due to its ability of dispersal, difficulty of capture, and fast rates of reproduction. Despite the Least Concern status of this species, taxonomic studies must be encouraged in order to evaluate the taxonomic status of the northernmost populations, for which several nominal taxa are available and morphological differences related to southern populations have been reported.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Through the studies of Bodmer (1994), Bodmer et al. (1997) and Hurtado-Gonzales and Bodmer (2004) we have known of Mazama nemorivaga populations that inhabit the margins of Yavari Miri and Tahuayo rivers, northeastern Peru. Apparently, these populations are not isolated from each other, as stated by Novaro et al. (2000).
In this region, the Amazonian brown brocket has considerably lower population densities than the red brocket. The density of the former is around 0.43-0.55 individuals per km² and its biomass estimates range from 6.5-8.2 kg/km². In contrast, red brocket deer usually have densities around 1.0 individuals per km² and a biomass of around 33 kg/km² (Salovaara et al. 2003).

Populations of Amazonian brown brocket were also reported in Suriname (Branan et al. 1985); in the Reserva Florestal Imataca, northeast of the state of Bolívar, Venezuela (Bisbal 1994); and in French Guiana (Gayot et al. 2004). Other populations of this deer are certainly present in many reserves or even private areas with well preserved forests. But the extant to which they are isolated from each other is unknown, due to the lack of knowledge on how this species responds to altered and fragmented habitats.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat destruction is certainly the main type of threat to this species, at least in Brazil where the deforestation in Amazonia started by the early decade of 1970 and reached 16.2% (forest loss) of the original forest in 2003 (Fearnside 2005). This threat is particularly strong across the “deforestation arch” in the southern Brazilian Amazon, a region that extends from the state of Acre eastward to the southern states of Pará and Maranhão.

Although the Amazon forest has been destroyed for many reasons, the main cause of deforestation is cattle raising, responsible for 70% of forest loss in the Brazilian Amazon (Fearnside 2005). Besides the destruction of forest, the cattle itself may negatively affect deer populations through a variety of parasitic, bacterial or viral diseases that can contaminate them. Indeed, Pinder and Leeuwenberg (1997) mentioned that there are reports of high mortality rates of deer previously in contact with ill cattle in the Brazilian Pantanal region and the states of Maranhão and Minas Gerais. The extent to which the cattle affect populations of M. nemorivaga is unknown.

Fortunately, overhunting appears not to be a threat to Mazama nemorivaga. This species is usually less abundant than the sympatric red brocket deer (M. americana), but also has lower hunting pressure. Branan et al. (1985) reported the harvest of 5 individuals of the former species against 57 individuals of the latter by Surinamese hunters in 1980 and 1981. Similarly, Hurtado-Gonzales and Bodmer (2004) found a rate of 0.06 individuals hunted/km² for M. nemorivaga in contrast to 0.17 individuals hunted/km² for M. americana in a heavy hunted site in northeastern Peru. In addition to the low hunting pressure, most studies on the sustainability of hunting by Peruvian rural and indigenous people reported that the harvest of Mazama nemorivaga is within sustainable limits (Ascorra 1997; Bodmer 1995; Bodmer et al. 1997; Hurtado-Gonzales and Bodmer 2004; Mena et al. 2000). There are two likely reasons for that. First, brockets (including M. americana and M. nemorivaga) can be categorized as less vulnerable to overhunting because of their fast rates of reproduction and intrinsic rates of population increase, allied to the ability of dispersal and difficulty of capture (see Bodmer et al. 1997, and Hurtado-Gonzales and Bodmer 2004). Second, slightly or unhunted areas adjacent to persistently hunted ones may have been acting as sources of game, as claimed by Novaro et al. (2000). According to them, 47 to 87% of unhunted area close to the catchment site is required to prevent a population decline of Amazonian brown brocket in the Peruvian Amazon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in several protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amazonian brown brocket

The Amazonian brown brocket (Mazama nemorivaga), also known as the small brown brocket, is a small species of deer that is almost entirely restricted to South America.[1][2] It is known from Panama (in Isla San José of the Pearl Islands only; endemic subspecies M. n. permira), Colombia, Venezuela, Guyana, Suriname, French Guiana, eastern Ecuador, eastern Peru, Brazil and possibly northern Bolivia.[1] Habitats it is found in include primarily nonflooded Amazonian tropical rainforest, and locally also tropical deciduous forest and xeric shrublands, at altitudes up to 1,500 metres (4,900 ft).[1] However, reports from the latter habitats may actually represent M. gouazoubira.[1]

Breeding occurs year round in some areas, with births tending to be concentrated in the rainy season. It is threatened by deforestation and by diseases spread by cattle, but not particularly by hunting.[1]

It is sympatric with the larger M. americana over much of its range (the latter tends to have significantly higher population densities), and reportedly also with M. gouazoubira in a few areas. It was considered a subspecies of M. gouazoubira, with which it is parapatric, until 2000.[1][3][4] Under normal viewing conditions it is not easily distinguished from M. gouazoubira, but unlike M. americana it is gray-brown overall with paler underparts.[3]

References[edit]

  1. ^ a b c d e f g Rossi, R. V. & Duarte, J. M. B. (2008). "Mazama nemorivaga". IUCN Red List of Threatened Species. Version 2010.3. International Union for Conservation of Nature. Retrieved 10 October 2010. 
  2. ^ "Mazama nemorivaga". ZipcodeZoo. BayScience Foundation, Inc. Retrieved 10 October 2010. 
  3. ^ a b Rossi, R. V. (2000). Taxonomia de Mazama Rafinesque, 1817 do Brasil (Artiodactyla, Cervidae). M.Sc. Thesis, Universidade de São Paulo.
  4. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 656. ISBN 978-0-8018-8221-0. OCLC 62265494. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!