Overview

Comprehensive Description

Comprehensive Description

Giant short-faced bears belong to the Ursidae family, which also includes black bears, grizzly bears and polar bears. Arctodus simus was very large in size with a short body and long slender limbs. Arctodus simus had a short neck, a short broad snout and a low forehead.

Giant short-faced bears lived during the middle and late Pleistocene (about 1.3 million to ~12,500 years ago), and were found in many different habitats in North America from the steppe-tundra to grasslands. Giant short-faced bears could have been carnivores (only ate other animals) or omnivores (ate both animals and plants). Recent studies suggest that Arctodus simus was a scavenger rather than a predator. Giant short-faced bears went extinct approximately 12,500 years ago.

New information on the Giant short-faced bear is being discovered all the time and opening the debate on the behavior and life-style of this giant bear.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

The first giant short-faced bears appeared during the middle Pleistocene (about 1.3 million years ago), and were widespread throughout North America. They were found from Alaska and northern Canada to Mexico, and from California to Virginia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Morphology

Giant short-faced bears belong to the Ursidae family, which also includes black bears, grizzly bears and polar bears. Arctodus simus was very large in size with a short body and long, slender limbs. Arctodus simus had a short neck, a short broad snout, and a low forehead with eyes that were set in the front of the skull. Its front and back feet pointed forward, which was different from most bears whose feet point inwards. It was also very light for its size and could move very quickly. The teeth of Arctodus simus were similar to the teeth of the brown bear. It had a front set of large canine teeth followed by many large, jagged molars. These teeth were used to cut into animal hide, tear and slice meat, and possibly grind coarse plant material.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Giant short-faced bears were extremely large in size. They were 1.5m at the shoulder, over 3m when standing with a 4.2m vertical reach, and weighed about 500kg. The size of Arctodus simus would vary depending on sex and location. Males were typically 15% bigger than females, and giant short-faced bears found in Alaska and the Yukon were much larger than individuals found in other locations.



Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Some giant short-faced bears could reach up to 700-800 kg in weight.
  • Christiansen, Per. "What size were Arctodus simus and Ursus spelaeus (Carnivora: Ursidae)?" Annales Zoologici Fennici 36 (1999): 93-102. Print.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Beth Sanzenbacher

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Giant short-faced bears lived during the middle and late Pleistocene (about 1.3 million to ~12,500 years ago), when the most recent ice ages took place. They were found in many different habitats in North America from the steppe-tundra to grasslands. Many fossil remains of Arctodus simus were also found in caves, and it appears that only the females lived in caves.



Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Trophic Strategy

What and how giant short-faced bears ate is hotly debated in the scientific community. Some think that Arctodus simus were carnivores, which means they only ate other animals. They ate large herbivores like bison, deer, horses and ground sloths. However, recent studies have found proof that Arctodus simus were omnivores, which means they ate both animals and plants.

Initially, scientists thought that Arctodus simus was an extremely powerful predator that skillfully hunted its prey. Several recent studies of Arctodus simus suggest that its body was not suited to hunting and it was more likely a scavenger. A scavenger eats animals that have been killed by other predators. Rather than a predator, Arctodus simus was a super-scavenger. Scientists are still researching these theories to discover how this giant bear obtained its food and what it ate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Giant short-faced bears went extinct approximately 12,500 years ago. During this time the last ice age ended and many large herbivores (like mammoths and mastodons) began to go extinct due to the change in climate and increased hunting pressure by humans. Arctodus simus ate many large herbivores, and the disappearance of these herbivores could have played a large role in its extinction. There is some evidence that competition from brown bears for food also played a role in the extinction of Arctodus simus but scientists are still researching and debating this theory.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Voise academy (3/24/2010)

What I learned about the woolly mammoth is that they live in the grasses lands in Europe, Siberia, and North America. They also live during the ice age times. Some wolly mammoths lived on small islands. Woolly mammoths also lived in Paul Island, Alaska until 5,706 years ago roamed on wrangle Island Siberia until about 3,700 years ago.
  • www.eol.org/pages/4454738
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: VAN MOORE

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Little is known about the behavior of Giant short-faced bears but from studying their fossils and their modern bear cousins, scientists can make a few educated guesses on their behavior. It is thought that Arctodus simus lived alone except for mothers with cubs and during mating times.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Arctodus simus belongs to the Ursidae family, which also includes black bears, grizzly bears and polar bears. There is one other well-known species of Arctodus, Arctodus pristinus or the short-faced bear. Arctodus pristinus is a primitive bear, and could be the ancestor of Arctodus simus. 

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sanzenbacher, Beth

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Voise academy (3/24/2010)

what I learned about moeritherium WAS that it was AN ANCIENT VELATIVE OF MAMMOTHS OR MASTODONS.CAME FROM Proboscidea ORDER, FROM THE MOERITHERIIDAE TREE
  • http://www.eol.org/pages/4526015
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: VAN MOORE

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Voise academy (3/24/2010)

What I learned about moeritherum was that it was ancient and was relative of mammoths and mastodons. They also came from proboscides order, from the moeritheriidae trees.
  • www.eol.org/pages/4526015
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: VAN MOORE

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctodus simus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2109-09|NC_011116|Arctodus simus| AACCGATGATTATTTTCCACAAACCATAAAGACATTGGTACCCTTTACCTCTTATTCGGTGCATGAGCTGGAATAGTGGGCACTGCCCTC---AGCCTCCTAATCCGTGCTGAACTAGGTCAACCCGGAGCTCTATTAGGGGAT---GATCAGATCTATAATGTGATCGTAACTGCTCATGCATTCGTGATAATCTTCTTTATAGTAATGCCTATCATAATTGGAGGCTTTGGAAACTGATTGGTGCCTTTAATA---ATTGGCGCCCCTGATATGGCATTTCCCCGGATGAATAATATAAGTTTCTGACTGCTGCCACCATCCTTCTTGCTACTTCTAGCCTCTTCTATAGTAGAGGCAGGCGCGGGAACTGGTTGAACTGTCTACCCCCCTCTAGCGGGCAATCTGGCCCATGCAGGAGCATCAGTAGACCTA---ACAATCTTCTCTTTACATTTAGCGGGCGTTTCCTCTATTCTAGGAGCTATCAACTTTATTACTACTATTATTAATATGAAACCCCCTGCAATATCTCAATATCAAACTCCTTTATTCGTATGATCGGTCCTAATTACGGCGGTACTTCTTCTTTTATCCTTACCAGTTCTAGCAGCT---GGGATCACTATACTGTTAACAGACCGAAACCTCAATACTACTTTCTTTGATCCGGCAGGAGGAGGGGATCCCATTCTGTACCAACACTTGTTTTGATTCTTTGGACACCCAGAAGTTTATATCTTAATTCTCCCTGGATTCGGAATAATCTCCCATATTGTCACATACTACTCAGGGAAAAAA---GAGCCCTTTGGTTATATAGGAATGGTTTGGGCAATGATATCCATTGGATTCTTAGGATTCATCGTGTGGGCTCATCACATGTTCACTGTAGGCATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arctodus simus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arctodus simus

  1. REDIRECT Arctodus
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!