Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Range Description

Southern Mexico to Southwestern Colombia (Simmons 2005). There is no record for El Salvador.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in evergreen and semideciduous lowland forests, tolerates second growth and disturbed habitats.
Highly Cluttered Space/Gleaning Frugivores (Kalko et al., 1996). Feeds on small figs, Cecropia fruits, etc. Roosts in small colonies in leaf tents. Reproduction seems to involve bimodal polyestry.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Artibeus watsoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Artibeus watsoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTGTACCTATTATTTGGTGCTTGAGCAGGTATAGTAGGCACCGCACTAAGCCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCTTATTAGGTGATGATCAAATTTATAATGTAATCGTCACAGCTCATGCTTTCGTAATGATTTTCTTTATAGTAATACCTATTATAATCGGAGGGTTCGGCAATTGACTAGTACCACTGATAATTGGCGCACCTGACATAGCATTCCCACGAATGAATAACATAAGCTTTTGACTCCTCCCACCCTCTTTTCTACTCTTACTTGCCTCTTCTACAGTTGAAGCTGGCGTTGGAACCGGTTGAACCGTGTACCCGCCACTAGCTGGAAATCTAGCACATGCCGGGGCTTCAGTCGATCTAGCTATTTTTTCTCTTCACCTAGCAGGGGTTTCATCAATCCTAGGAGCTATCAATTTTATTACTACAATCATCAATATAAAACCACCAGCCTTATCTCAATATCAGACGCCCCTATTTGTCTGATCCGTTTTAATTACTGCTGTCCTGTTACTCCTATCTCTTCCCGTTTTAGCAGCGGGTATTACCATACTTCTAACAGATCGAAATCTCAACACCACGTTCTTTGACCCTGCTGGAGGAGGAGATCCTATTCTATATCAACATCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Miller, B., Reid, F., Arroyo-Cabrales, J., Cuarón, A.D. & de Grammont, P.C.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Artibeus watsoni is usually found below 800 m above sea level, in semideciduous and evergreen lowland forests, second growth, and fruit groves (Reid 1997). It feeds primarily on fruits, although to a lesser extent may consume insects and pollen (LaVal and Rodrıguez-H 2002).
Abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Found in protected areas. In Mexico is listed as subject to special protection under NOM - 059 - SEMARNAT - 2001 (Arroyo-Cabrales pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thomas's fruit-eating bat

Thomas's fruit-eating bat (Artibeus watsoni), sometimes also popularly called Watson's fruit-eating bat,[2] is a species of bat in the family Phyllostomidae.[3] It is found in southern Mexico, Belize, Guatemala, Honduras, Nicaragua, Costa Rica, Panama and Colombia. The species name is in honor of H. J. Watson, a plantation owner in western Panama who used to send specimens to the British Natural History Museum, where Oldfield Thomas would often describe them.[2][4]

References[edit]

  1. ^ Miller, B., Reid, F., Arroyo-Cabrales, J., Cuarón, A.D. & de Grammont, P.C. (2008). Artibeus watsoni. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 11 March 2009.
  2. ^ a b Beolens, Bo; Watkins, Michael; Grayson, Michael (2009-09-28). The Eponym Dictionary of Mammals. Baltimore: The Johns Hopkins University Press. pp. 592 (see p. 440). ISBN 978-0-8018-9304-9. OCLC 270129903. 
  3. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 420. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ Goldman, Edward Alphonso (1920). Mammals of Panama. Washington D.C.: Smithsonian Institution. pp. (see p. 16). 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!