Articles on this page are available in 1 other language: Spanish (10) (learn more)

Molecular Biology and Genetics

Molecular Biology

Barcode data: Artibeus watsoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTGTACCTATTATTTGGTGCTTGAGCAGGTATAGTAGGCACCGCACTAAGCCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCTTATTAGGTGATGATCAAATTTATAATGTAATCGTCACAGCTCATGCTTTCGTAATGATTTTCTTTATAGTAATACCTATTATAATCGGAGGGTTCGGCAATTGACTAGTACCACTGATAATTGGCGCACCTGACATAGCATTCCCACGAATGAATAACATAAGCTTTTGACTCCTCCCACCCTCTTTTCTACTCTTACTTGCCTCTTCTACAGTTGAAGCTGGCGTTGGAACCGGTTGAACCGTGTACCCGCCACTAGCTGGAAATCTAGCACATGCCGGGGCTTCAGTCGATCTAGCTATTTTTTCTCTTCACCTAGCAGGGGTTTCATCAATCCTAGGAGCTATCAATTTTATTACTACAATCATCAATATAAAACCACCAGCCTTATCTCAATATCAGACGCCCCTATTTGTCTGATCCGTTTTAATTACTGCTGTCCTGTTACTCCTATCTCTTCCCGTTTTAGCAGCGGGTATTACCATACTTCTAACAGATCGAAATCTCAACACCACGTTCTTTGACCCTGCTGGAGGAGGAGATCCTATTCTATATCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Artibeus watsoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thomas's fruit-eating bat

Thomas's fruit-eating bat (Artibeus watsoni), sometimes also popularly called Watson's fruit-eating bat,[2] is a species of bat in the family Phyllostomidae.[3] It is found in southern Mexico, Belize, Guatemala, Honduras, Nicaragua, Costa Rica, Panama and Colombia. The species name is in honor of H. J. Watson, a plantation owner in western Panama who used to send specimens to the British Natural History Museum, where Oldfield Thomas would often describe them.[2][4]

References[edit]

  1. ^ Miller, B., Reid, F., Arroyo-Cabrales, J., Cuarón, A.D. & de Grammont, P.C. (2008). Artibeus watsoni. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 11 March 2009.
  2. ^ a b Beolens, Bo; Watkins, Michael; Grayson, Michael (2009-09-28). The Eponym Dictionary of Mammals. Baltimore: The Johns Hopkins University Press. p. 440. ISBN 978-0-8018-9304-9. OCLC 270129903. 
  3. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 420. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ Goldman, Edward Alphonso (1920). Mammals of Panama. Washington D.C.: Smithsonian Institution. pp. (see p. 16). 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!