Overview

Distribution

Range Description

Pipistrellus pygmaeus was only recently differentiated from P. pipistrellus, and some details of its distribution are still lacking. It is also a western Palaearctic species, occurring from the British Isles through much of Europe (including the islands of Corsica and Sardinina) east to Ukraine and western Russia. Its range may extend much further east, as well as into north Africa (Wilson and Reeder 2005), however, repeated surveys for it in Morocco have failed to find any records so it may not occur in North Africa at all (J. Juste pers. comm. 2007), although it is also possible that the species does not occur outside Europe. It occurs further north in Scandinavia than P. pipistrellus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It forages around woodland and wetlands, and is more closely associated with water than P. pipistrellus. It feeds mainly on small Diptera (especially aquatic midges). Maternity colonies are generally located in buildings. No specific data are available on P. pygmaeus winter roost sites, but presumably they are similar to those used by P. pipistrellus.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pipistrellus pygmaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pipistrellus pygmaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTTTTATTTGGTGCCTGAGCTGGAATAGTAGGCACCGCACTAAGTCTACTAATTCGTGCTGAATTAGGCCAACCTGGGGCACTACTTGGGGACGATCAGATTTATAATGTAATCGTAACAGCCCACGCTTTTGTAATAATTTTTTTTATAGTAATGCCTATTATAATCGGGGGCTTTGGAAACTGACTGGTTCCACTTATGATCGGAGCCCCCGACATGGCCTTTCCTCGTATAAATAATATGAGTTTCTGACTTCTGCCCCCTTCTTTTCTACTACTACTAGCCTCATCTATAGTGGAAGCGGGAGCGGGTACGGGCTGAACAGTCTATCCCCCTCTAGCAGGAAACCTCGCCCATGCGGGAGCCTCCGTGGATTTAACTATTTTCTCTCTGCACCTGGCGGGTGTATCATCTATTCTAGGGGCAATTAATTTTATTACTACAGTTATTAACATGAAACCCCCTGCCCTCTCCCAATACCAAACACCACTGTTTGTCTGATCAGTACTAATTACAGCCGTTCTTCTCTTATTATCACTCCCAGTGCTTGCCGCTGGTATTACAATACTATTAACAGACCGAAATCTAAACACAACCTTTTTTGACCCCGCAGGAGGAGGAGACCCCATCCTGTATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Spitzenberger, F., Aulagnier, S., Coroiu, I., Karataş, A., Juste, J., Paunovic, M., Palmeirim, J. & Benda, P.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
The species is widespread and abundant, and there is no evidence of current significant population decline. Consequently it is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It generally appears to be less abundant than P. pipistrellus sensu stricto, although it is nevertheless a widespread and abundant species. Summer colonies may be larger than P. pipistrellus, numbering up to 250 (or occasionally up to 3,000) individuals. It is not known if the species congregates in winter, or what size its winter colonies are.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
As maternity colonies tend to be found in buildings, the species may be vulnerable to anthropogenic factors, such as disturbance, timber treatment and building renovation (Battersby 2005). However, this is not thought to be a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected under national law in most range states. It is also protected under international law through the Bonn Convention (Eurobats) and Bern Convention in parts of its range where these apply, and is included in Annex IV of the EU Habitats and Species Directive. It occurs in many protected areas. No specific conservation actions are known.

Adoption of bat-friendly practices in the construction and maintenance of buildings is a proposed action.

Although this species was only recently described, it is apparently widespread and abundant. However, further clarification of its distribution, population size and trend, habitat preferences, and ecology is required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Soprano pipistrelle

The soprano pipistrelle (Pipistrellus pygmaeus) is a small bat that was only formally separated from the common pipistrelle (Pipistrellus pipistrellus) in 1999.

The two species were first distinguished on the basis of their different-frequency echolocation calls. The common pipistrelle uses a call of 45 kHz, while the soprano pipistrelle echolocates at 55 kHz. The two species are sometimes called the 45 kHz pipistrelle and the 55 kHz pipistrelle, or the bandit pipistrelle (common) and the brown pipistrelle (soprano). Since the two species were split, a number of other differences, in appearance, habitat and food, have also been discovered.

Echolocation[edit]

P. pygmaeus (55 Pip) call on heterodyne bat detector, recorded in stereo 187 kHz

The frequencies used by this bat species for echolocation lie between 53 and 86 kHz, have most energy at 55 kHz and have an average duration of 5.8 ms.[1][2]

References[edit]

  1. ^ Parsons, S. and Jones, G. (2000). "Acoustic identification of twelve species of echolocating bat by discriminant function analysis and artificial neural networks". The Journal of experimental biology 203 (Pt 17): 2641–56. PMID 10934005. 
  2. ^ Obrist, M.K., Boesch, R. and Flückiger, P.F. (2004). "Variability in echolocation call design of 26 Swiss bat species: Consequences, limits and options for automated field identification with a synergic pattern recognition approach". Mammalia 68 (4): 307–32. doi:10.1515/mamm.2004.030. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!