Overview

Comprehensive Description

General Description

This large and fairly robust geometrid moth that mimics wilted leaves with its jagged, rust and brown wings. Ground colour rust-tan with brighter rust shades at the wing margins, and a pinkish white shade along the forewing costa; and with three dark brown transverse lines. Very similar to S. kentaria, but in general slightly smaller and darker rusty browns (more yellow-brown in kentaria; alciphearia has the PM line straighter on both wings (best seen on the underside). S. kentaria usually has a jagged or wavy forewing PM line with a more pronounced indentation midway, and the hindwing PM line is more irregular and slightly curved outwardly (straight or nearly so in alciphearia). Some specimens may be impossible to determine without examining the genitalia (see McGuffin, 1987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Yukon and BC east to Labrador, south to New York and North Carolina (McGuffin 1987, Wagner et al. 2001). Found throughout the parklands and boreal forest regions in Alberta.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Mixedwood and deciduous forests and woodlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Larvae feed on deciduous shrubs, particularly willows (Salix spp.) and alder (Alnus spp.), also on Ribes and paper birch (Betula papyrifera. (McGuffin 1987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

A spring-flying moth, peaking throughout May.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The immature stages are described in detail by McGuffin (1987). Larvae are twig mimics and cannot be separated from those of S. kentaria (see Ives & Wong 1988, Wagner et al. 2001). Pupae hibernate in a cocoon between leaves, often on the host (McGuffin 1987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selenia alciphearia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCCGGTATAGTAGGAACTTCTTTAAGTATATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGCGATGATCAAATTTATAATACTATTGTAACTGCACATGCCTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCATTAATATTGGGGGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTATTACTCTTTTAATCTCAAGAAGAATTGTGGAAAATGGGGCTGGAACCGGTTGAACAGTTTACCCTCCCCTATCTTCTAATATTGCTCATGGGGGTAGTTCAGTAGATTTGGCTATTTTTTCCTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATCACCACAATCATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGGGCTGTTGGAATTACAGCTTTTTTACTCCTATTGTCATTACCTGTACTAGCCGGAGCTATTACCATATTACTAACCGACCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Selenia alciphearia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 68
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!