Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Selenia tetralunaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Selenia tetralunaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTCTATTAATTCGGGCTGAATTAGGAAACCCCGGATCATTAATTGGAGATGATCAAATTTATAACACTATTGTAACCGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCCCTAATATTAGGAGCTCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTATTACCCTTTTAATCTCAAGAAGAATTGTCGAAAATGGTGCTGGAACTGGTTGAACAGTTTATCCCCCATTATCCTCCAATATTGCTCATGGAGGTAGTTCAGTAGATTTAGCTATTTTTTCCTTACATTTAGCGGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCCTTATTTGTTTGAGCTGTTGGAATTACAGCTTTTTTATTATTACTATCATTACCTGTGTTAGCAGGAGCTATCACTATGCTGTTGACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Purple Thorn

Selenia.tetralunaria.7138.jpg

The Purple Thorn (Selenia tetralunaria) is a moth of the family Geometridae. It is a species of northern and central Europe. It has a scattered distribution in Britain but is absent from Ireland.

This species is dark purplish-brown, paler towards the termen, with a dark spot at the apex of the forewing. Both wings are marked with a comma-shaped white mark. The margins of the wings are angular, giving the species a distinctive shape. Two broods are produced each year and they differ considerably in size and colour. Adults of the spring brood, which fly in April and May, have a wingspan of 46–52 mm. Moths of the summer brood, flying in July and August,[1] are smaller (wingspan 44–46 mm) and darker. The species flies at night and is attracted to light.

The caterpillar feeds on a variety of trees and shrubs (see list below). The species overwinters as a pupa.

Notes[edit]

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

Recorded food plants[edit]

References[edit]

  • Chinery, Michael, 1986 (Reprinted 1991). Collins Guide to the Insects of Britain and Western Europe.
  • Skinner, Bernard, 1984. Colour Identification Guide to Moths of the British Isles.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!