Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Phryxe magnicornis is endoparasitoid of larva of Selenia dentaria

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selenia dentaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCCGGCATAGTAGGAACTTCTTTAAGTATATTAATTCGAGCTGAATTAGGAAATCCCGGATCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCACATGCCTTTATTATAATTTTTTTTATAGTGATGCCCATTATAATTGGAGGATTTGGTAATTGATTAATCCCATTAATATTGGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTGCCCCCTTCTATTACTCTTTTAATCTCAAGAAGAATTGTAGAAAATGGGGCTGGAACCGGTTGAACAGTTTACCCTCCTTTGTCTTCTAATATTGCTCATGGGGGTAGTTCAGTAGATTTGGCTATTTTTTCCTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCCATTAATTTTATTACCACAATCATTAATATACGATTAAATAATTTATCTTTTGATCAGATACCATTATTTGTTTGAGCTGTTGGAATTACAGCTTTTTTACTTTTATTGTCATTACCAGTACTGGCCGGAGCTATTACCATATTACTAACCGACCGAAATTTAAATACATCATTTTTTGACCCCGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Selenia dentaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Selenia dentaria


The Early Thorn (Selenia dentaria) is a moth of the family Geometridae. It is found in Northern Europe, Northern and Eastern Asia.

The wingspan is 28–40 mm. The moth flies in two generation from April to August [1].

Caterpillar

The larva feed on various deciduous trees, such as birch and alder.

Notes[edit]

  1. ^ The flight season refers to Belgium and The Netherlands. This may vary in other parts of the range.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!