Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Phryxe magnicornis is endoparasitoid of larva of Selenia dentaria

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selenia dentaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCCGGCATAGTAGGAACTTCTTTAAGTATATTAATTCGAGCTGAATTAGGAAATCCCGGATCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCACATGCCTTTATTATAATTTTTTTTATAGTGATGCCCATTATAATTGGAGGATTTGGTAATTGATTAATCCCATTAATATTGGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTGCCCCCTTCTATTACTCTTTTAATCTCAAGAAGAATTGTAGAAAATGGGGCTGGAACCGGTTGAACAGTTTACCCTCCTTTGTCTTCTAATATTGCTCATGGGGGTAGTTCAGTAGATTTGGCTATTTTTTCCTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCCATTAATTTTATTACCACAATCATTAATATACGATTAAATAATTTATCTTTTGATCAGATACCATTATTTGTTTGAGCTGTTGGAATTACAGCTTTTTTACTTTTATTGTCATTACCAGTACTGGCCGGAGCTATTACCATATTACTAACCGACCGAAATTTAAATACATCATTTTTTGACCCCGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Selenia dentaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Selenia dentaria


The Early Thorn (Selenia dentaria) is a moth of the family Geometridae. It is found in Northern Europe, and across the Palearctic to the Caucasus, Transcaucasia, North Siberia, Russian Far East, Amur and Mongolia.

Description[edit]

The wingspan is 28–40 mm. The wings are scalloped and there are 3 crosslines on the forewings. There is a dark stain at the apex of the forewing.Adults are extremely variable in colour.Distinguished by the less deep excision between the radials of the hindwing, less rich colouring, enlarged costal spots at the origin of the lines, median area not differentiated in colour from distal area, transparent discal marks not well developed. The spring form is large, strongly irrorated with fuscous, sometimes more olivaceous.the median and postmedian lines darkened into a band. -ab. illunaria Esp. is the summer generation, much smaller and much lees irrorated. Sometimes pale, sometimes warmer brown. - ab. minima Strand is a dwarfed form, sometimes sharply marked, frequent in Arctic Norway.[1]

Caterpillar

The larva is orange-brown or reddish brown,sometimes inclining to purplish; mepo- and metathorax enlarged laterally, 4th—5th abdominal swollen, with small dorsal humps; anterior segments marked with bright orange.

Biology[edit]

The moth flies in two generation from April to August [1].

The larva feed on various deciduous trees, such as birch and alder.

Notes[edit]

  1. ^ The flight season refers to Belgium and The Netherlands. This may vary in other parts of the range.

References[edit]

  1. ^ Prout , L.B. 1912–16. Geometridae. In A. Seitz (ed.) The Macrolepidoptera of the World. The Palaearctic Geometridae, 4. 479 pp. Alfred Kernen, Stuttgart.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!