Overview
Comprehensive Description
Description
Venus verrucosa is a bivalve mollusc with equally sized valves that can grow up to 7 cm. It is beige to brown in colour with a white internal surface. The warty venus is characterized by a series of 20 or more prominent concentric ridges intersected by radiating grooves resulting in wart-like spines. Also, the escutcheon, the depression behind the umbones that encompass the external ligament, is much wider and semi-eliptical on the left valve and marked with transverse brown stripes.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Distribution
Adriatic Sea, Azores Exclusive Economic Zone, Baia do Mussulo, Banc d'Arguin, Belgian Exclusive Economic Zone, Bizerte Lagoon, British Isles, East Atlantic, English Channel, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Gabès, Irish Exclusive economic Zone, Mauritania, Mediterranean Sea, Moroccan Exclusive Economic Zone, Mozambique, Namibia, North Coast of Tunisia, Red Sea, South Coast of Africa, South Coast of South Africa, Tunis Gulf, United Kingdom Exclusive Economic Zone, West Africa, West Coast of Scotland, West Coast of South Africa, Wimereux
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
MacNae, W. & M. Kalk (eds) (1958). A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. I-iv, 163 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6266
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
Vine, P. (1986). Red Sea Invertebrates. Immel Publishing, London. 224 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5987
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
-
Gofas, S.; Afonso, J.P.; Brandào, M. (Ed.). (S.a.). Conchas e Moluscos de Angola = Coquillages et Mollusques d'Angola. [Shells and molluscs of Angola]. Universidade Agostinho / Elf Aquitaine Angola: Angola. 140 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=7026
-
Wolff, W.J.; Duiven, P.; Esselink, P.; Gueve, A. (1993). Biomass of macrobenthic tidal flat fauna of the Banc d'Arguin, Mauritania. Hydrobiologia 258(1-3): 151-163
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=8619
-
Ly B., Diop M., Girardin M.,Guide et nomenclature nationale commerciale des espèces marines (poissons, crustacès et mollusques) pechèes en Mauritanie
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9810
-
Branch, G.M. et al. (2002). Two Oceans. 5th impression. David Philip, Cate Town & Johannesburg.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6561
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
Ardovini, R.; Cossignani, T. (2004). West African seashells (including Azores, Madeira and Canary Is.) = Conchiglie dell'Africa Occidentale (incluse Azzorre, Madeira e Canarie). English-Italian edition. L'Informatore Piceno: Ancona, Italy. ISBN 88-86070-11-X. 319 pp.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=7029
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Lioris, D., Rucabado, J. 1998. Guide d'identification des Ressources Marines Vivantes du Maroc. Guide FAO d'identification des espèces pour les besoins de la pêche. Organisation des Nations Unies pour l'Alimentation et l'Agriculture : 263pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164103
-
Zamouri-Langar, N.; Chouba, L.; Ajjabi Chebil, L.; Mrabet, R.; El Abed, A. (2011). Les coquillages bivalves des côtes tunisiennes. Institut National des Sciences et Technologies de la Mer: Salammbô. ISBN 978-9938-9512-0-2. 128 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164127
-
Risso, J.C. 1978. Faune malacologique de la plateforme tunisienne. Etude de quelques dragages et carottages effectués à l'intérieur et au large du golfe de Gabès. Bull. Inst. Nat. Sc. Oceanogr. Pêche, Salammbô, 5 (1-4): 17-41.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164112
-
Azzouz, A. 1973. Les fonds chalutables de la région nord de la Tunisie cadre physique et biocenoses benthiques. Bull. Inst. Nat. Sc. Oceanogr. Pêche, Salammbô, 2: 473-563.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164071
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Morphology
Original description, by Linnaeus (1758, p. 685):
"V. testa subcordata : sulcis membranaceis striatis reflexis antice imprimis verrucosis, margine crenulato.
Gualt. test. t. 83. f. G.
Habitat in Europa australi.
Statura & maculis ad praecedentem accedit, ut forte varietas laevigata."
© Sartori, André F.
Source:
Molluscs - eBivalvia LifeDesk
Trusted
Ecology
Habitat
Known from the nearshore.
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0 - 122.53
Temperature range (°C): 9.620 - 15.917
Nitrate (umol/L): 3.128 - 9.954
Salinity (PPS): 34.402 - 35.363
Oxygen (ml/l): 4.619 - 6.439
Phosphate (umol/l): 0.351 - 0.831
Silicate (umol/l): 2.578 - 7.971
Graphical representation
Depth range (m): 0 - 122.53
Temperature range (°C): 9.620 - 15.917
Nitrate (umol/L): 3.128 - 9.954
Salinity (PPS): 34.402 - 35.363
Oxygen (ml/l): 4.619 - 6.439
Phosphate (umol/l): 0.351 - 0.831
Silicate (umol/l): 2.578 - 7.971
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0 - 122.53
Temperature range (°C): 9.620 - 15.917
Nitrate (umol/L): 3.128 - 9.954
Salinity (PPS): 34.402 - 35.363
Oxygen (ml/l): 4.619 - 6.439
Phosphate (umol/l): 0.351 - 0.831
Silicate (umol/l): 2.578 - 7.971
Graphical representation
Depth range (m): 0 - 122.53
Temperature range (°C): 9.620 - 15.917
Nitrate (umol/L): 3.128 - 9.954
Salinity (PPS): 34.402 - 35.363
Oxygen (ml/l): 4.619 - 6.439
Phosphate (umol/l): 0.351 - 0.831
Silicate (umol/l): 2.578 - 7.971
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Venus verrucosa is found partly buried in sand and gravel substrata. It is most commonly found from the low intertidal down to about 100 m.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Venus verrucosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATTCGNATGGAGTNGGCTATACCTGGAAAAATGTTGGACGAT---GGTCAGTTATATAATTTGATTGTTACGGCTCATGGGCTAGTAATAATTTTTTTTTTGGTGATGCCTATAATAATTGGTGGATTTGGTAATTGGTTGGTTCCTCTAATATTAACTATACCAGATATAGCGTTTCCTCGAATGAACAATCTTAGATTTTGATTATTACCTGTATCAATATTATTATTATTGGGTTCTGCTTATGTTGATGGCGGTGCTGGGACAGGCTGGACTATTTATCCCCCTTTATCTAGAGCTCTCTCTCATTCAGGATGTGCTATGGATTATGTTATTTTCTCTCTCCATATTGGTGGTATATCTTCCATCTTAGCATCCCTTAACTTTGTAACAACTAGGTTTTGTATGCGTCCTGGGGTAATGACGTTGTTGCGAACTACTATATTTGTTTGGTGTGTAGCTGTAACCGGATTTTTGTTGATTGTTGCTATGCCTGTTTTGGCTGCTGCCCTAACGATACTTTTGACTGATCGTAATTTTAACACTTCTTTCTTTGATCCT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Venus verrucosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Warty venus
The warty venus, Venus verrucosa, is a species of saltwater clam. They are marine bivalve molluscs in the family Veneridae, sometimes known as the Venus clams.
Contents |
Distribution
This species is found around the European coast and also the southern African coast, from the Namibian coast to Mozambique, subtidally to 155 m.[1]
Description
This animal grows up to 60 mm in diameter. It has a bulky, oval shell with well defined concentric ridges. The shell edges are knobbly.[1]
Ecology
The warty venus burrows in mud and sand.
References
- ^ a b Branch, G.M., Branch, M.L, Griffiths, C.L. and Beckley, L.E (2005): Two Oceans: a guide to the marine life of southern Africa ISBN 0-86486-672-0
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
