Overview

Comprehensive Description

Description

 Venus verrucosa is a bivalve mollusc with equally sized valves that can grow up to 7 cm. It is beige to brown in colour with a white internal surface. The warty venus is characterized by a series of 20 or more prominent concentric ridges intersected by radiating grooves resulting in wart-like spines. Also, the escutcheon, the depression behind the umbones that encompass the external ligament, is much wider and semi-eliptical on the left valve and marked with transverse brown stripes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Original description, by Linnaeus (1758, p. 685):
"V. testa subcordata : sulcis membranaceis striatis reflexis antice imprimis verrucosis, margine crenulato.
Gualt. test. t. 83. f. G.
Habitat in
Europa australi.
Statura & maculis ad praecedentem accedit, ut forte varietas laevigata."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0 - 122.53
  Temperature range (°C): 9.620 - 15.917
  Nitrate (umol/L): 3.128 - 9.954
  Salinity (PPS): 34.402 - 35.363
  Oxygen (ml/l): 4.619 - 6.439
  Phosphate (umol/l): 0.351 - 0.831
  Silicate (umol/l): 2.578 - 7.971

Graphical representation

Depth range (m): 0 - 122.53

Temperature range (°C): 9.620 - 15.917

Nitrate (umol/L): 3.128 - 9.954

Salinity (PPS): 34.402 - 35.363

Oxygen (ml/l): 4.619 - 6.439

Phosphate (umol/l): 0.351 - 0.831

Silicate (umol/l): 2.578 - 7.971
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Venus verrucosa is found partly buried in sand and gravel substrata. It is most commonly found from the low intertidal down to about 100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Venus verrucosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCGNATGGAGTNGGCTATACCTGGAAAAATGTTGGACGAT---GGTCAGTTATATAATTTGATTGTTACGGCTCATGGGCTAGTAATAATTTTTTTTTTGGTGATGCCTATAATAATTGGTGGATTTGGTAATTGGTTGGTTCCTCTAATATTAACTATACCAGATATAGCGTTTCCTCGAATGAACAATCTTAGATTTTGATTATTACCTGTATCAATATTATTATTATTGGGTTCTGCTTATGTTGATGGCGGTGCTGGGACAGGCTGGACTATTTATCCCCCTTTATCTAGAGCTCTCTCTCATTCAGGATGTGCTATGGATTATGTTATTTTCTCTCTCCATATTGGTGGTATATCTTCCATCTTAGCATCCCTTAACTTTGTAACAACTAGGTTTTGTATGCGTCCTGGGGTAATGACGTTGTTGCGAACTACTATATTTGTTTGGTGTGTAGCTGTAACCGGATTTTTGTTGATTGTTGCTATGCCTGTTTTGGCTGCTGCCCTAACGATACTTTTGACTGATCGTAATTTTAACACTTCTTTCTTTGATCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Venus verrucosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Warty venus

The warty venus, Venus verrucosa, is a species of saltwater clam. They are marine bivalve molluscs in the family Veneridae, sometimes known as the Venus clams.

Distribution[edit]

This species is found around the European coast and also the southern African coast, from the Namibian coast to Mozambique, subtidally to 155 m.[1]

Description[edit]

A fossilized shell of Venus verrucosa

This animal grows up to 60 mm in diameter. It has a bulky, oval shell with well defined concentric ridges. The shell edges are knobbly.[1]

Economic import and gastronomy[edit]

Known as praire in France, it is an expensive delicacy there, and harvesting periods and size of catch (both minimum shell size and numbers taken) have had to be strictly regulated for its conservation. It is eaten either raw or baked in the oven with garlic butter.

Ecology[edit]

The warty venus burrows in mud and sand.

References[edit]

  1. ^ a b Branch, G.M., Branch, M.L, Griffiths, C.L. and Beckley, L.E (2005): Two Oceans: a guide to the marine life of southern Africa ISBN 0-86486-672-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!