Overview

Brief Summary

Introduction

Diagnosis

A Gonatus with ...

  • 3 hooks and one sucker proximal to large central hook on club.
  • 2 large chromatophores on ventral side of head medial to eyes (see title drawing).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Number of suckers in proximal half of each arm IV = 62 at 129 mmGL (neotype), range for all sizes- about 55-69.
  2. Tentacles
    1. Clubs 12-20% of GL (15% in neotype).
    2. Club dactylus with suckers in 7-8 irregular series at base decreasing to 4 sucker series about half way out dactylus; suckers nearly same size in transverse series.
    3. Club ventral-marginal zone with 4 series of suckers in central region; medial suckers ca. one-half diameter of suckers of other three series. Occasionally 1-2 small suckers present as a partial fourth series.
    4. Club dorsal-marginal zone with 3-4 irregular series of suckers.
    5. Club medial zone with large central hook; small distal hook and proximal series with usually 3 small hooks and one sucker, with largest hook never closest to large central hook (i. e., hooks initially increase in size proximally). About a quarter of squid lack sucker, about 10% have 4 hooks and one sucker and about 3% have 2 hooks only.

      Figure. Oral view of the proximal hooks of the medial zone and suckers of the ventral-marginal zone of the club of G. fabricii, fresh. Photograph by M. Vecchione with transmitted light taken aboard the R/V G. O. SARS during the MARECO cruise to the central North Atlantic

    6. Total number of suckers (excluding terminal pad, medial zone) on tentacular club: 155-229.
    7. Median region of tentacular stalk between marginal series with usually 40-80 suckers (range 38-109).

    8. Figure. Oral views of the tentacle and club of G. fabricii 129 mm GL, neotype. Top - Tentacle. Bottom - Enlargement of the tentacular club. Drawings from Kristensen (1981).


      Figure. Oral view of the tentacular club of G. fabricii, fresh. Same club photographed above. Photograph by M. Vecchione.

  3. Head
    1. Radula
      1. All lateral teeth of radula smooth, without ridges.
      2. Figure. Radula of G. fabricii, 106 mm ML. Drawing from Kristensen (1981).

    2. Funnel
      1. Ventral pads of funnel organ about half as long as each rami of dorsal pad.
      2. Figure. Funnel organ of G. fabricii, 129 mmML, neotype. Drawing from Kristensen (1981).

  4. Pigmentation
    1. Two unusually large chromatophores lie deep on the ventral surface of the head.

Comments

The above description, except for photographs, is from Kristensen (1981). More details of the description can be found here.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the Arctic and subarctic waters of the North Atlantic. Its distribution includes Newfoundland, Greenland and the Barents Sea (Roper et al. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality: The neotype was taken at the entrance of Amerdloq Fjord at Holsteinsborg (approximately 67°N, 54°W), West Greeland, 250-285 fms.


Figure. Distribution of Gonatus spp. in the North Atlantic. Blue - G. steenstrupi. Red - G. fabricii. General map with dots and triangles from Kristensen (1981). Red and blue lines based mostly on paralarvae, from Falcon, et al. (2000).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is an oceanic species occurring in midwater depths (~500 m; Roper et al. 2010). Off Greenland, the highest abundances occur below 400 m in depth (Zumholz and Frandsen 2006). In this region, adults probably spend the day on or near the bottom before ascending into the water column at night to feed (Zumholz and Frandsen 2006). Off Greenland, spawning probably occurs in autumn and early winter (Zumholz and Frandsen 2006), and off Norway from winter to summer (Roper et al. 2010). Elsewhere spawning appears to extend from mid-April to December, peaking late May and June (Roper et al. 2010). At maturity females lose both their tentacles and suckers on their arms (Vecchione and Pohle 2002), suggesting egg masses may be brooded in their arms like other members of the genus (e.g. G. onyx). Planktonic paralarval young hatch out from relatively large eggs (e.g. mature ovarian oocyte length was approx. 5 mm in length; Vecchione and Young 2006). Juveniles occur in surface waters in the northwest Atlantic (Roper et al. 1984). Unvalidated statolith increment counts suggest that this species is slow-growing with a lifespan of less than two years (Arkhipkin and Bjørke 2000)

Juveniles feed on a range of prey including chaetognaths, copepods, euphausids and amphipods, however, beyond 25 mm in mantle length fish becomes important in their diet (Roper et al. 2010). Adults can feed on very large prey (Roper et al. 2010). They are preyed upon by a range of marine mammals (e.g. sperm whales) and fish (e.g. gadoids; (Roper et al. 2010).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

epipelagic, glacial
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

epi-mesopelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 72 specimens in 1 taxon.
Water temperature and chemistry ranges based on 55 samples.

Environmental ranges
  Depth range (m): 65 - 3321.5
  Temperature range (°C): 0.191 - 13.742
  Nitrate (umol/L): 6.592 - 42.085
  Salinity (PPS): 33.767 - 35.328
  Oxygen (ml/l): 0.584 - 6.972
  Phosphate (umol/l): 0.575 - 3.256
  Silicate (umol/l): 4.311 - 125.886

Graphical representation

Depth range (m): 65 - 3321.5

Temperature range (°C): 0.191 - 13.742

Nitrate (umol/L): 6.592 - 42.085

Salinity (PPS): 33.767 - 35.328

Oxygen (ml/l): 0.584 - 6.972

Phosphate (umol/l): 0.575 - 3.256

Silicate (umol/l): 4.311 - 125.886
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

The mature egg, found in the vicinity of the ovary of a mature female, is nearly spherical and almost 5 mm in the longest axis (Kristensen, 1981). Egg masses have never been observed in nature.

Paralarvae of G. fabricii are most easily separated from the partially sympatric species, G. steenstrupi, by the two large photophores on the ventral surface of the head that distinguish the adults as well. The full chromatophore pattern of the paralarva is not known. The number of suckers on arms I-IV is useful at sizes greater than 13 mm ML as is the form of the funnel organ in all but smallest paralarvae. The paralarval stage appears to end at about 20 mm ML which corresponds with hook development and movement into deeper water (Falcon, et al., 2000).


Figure. Ventral views of growth stages of G. fabricii showing the head chromatophores and the form of the funnel organ. Drawings from Falcon, et al. (2000).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus fabricii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACTTTATCTTTGGTATTTGAGCAGGCCTGCTAGGGACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGGCAACCTGGCTCTTTACTAAACGAC---GATCAACTCTATAATGTTGTAGTTACAGCCCATGGATTTATCATAATTTTTTTTCTAGTAATACCTATTATAATTGGTGGATTTGGTAACTGACTTGTCCCCTTAATATTAGGAGCCCCAGACATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTATTACCCCCTTCCTTAACACTATTGTTAGCTTCCTCAGCCGTTGAAAGAGGGGCAGGGACAGGATGAACAGTGTACCCCCCTCTTTCCAGAAATTTATCTCATGCAGGTCCTTCAGTTGACTTAGCCATTTTTTCTCTACATTTAGCAGGTGTGTCTTCTATTCTAGGGGCCATTAATTTCATTACTACAATTTTAAATATACGATGAGAAGGATTACAAATAGAACGATTACCTCTCTTTGCTTGATCAGTRTTTATTACCGCAATTTTATTACTTCTATCTCTCCCTGTTCTAGCCGGAGCTATTACTATATTATTAACTGATCGAAACTTTAATACAACCTTTTTTGACCCAAGGGGAGGAGGGGATCCTATCTTATACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus fabricii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Young, R., Vecchione, M. & Böhm, M.

Contributor/s
Duncan, C. & Carrete-Vega, G.

Justification

Gonatus fabricii is an oceanic species which has been assessed as Least Concern, as it has a wide geographic distribution and is subject to only small-scale fishing pressure. However, further research is recommended in order to determine the precise distribution, population dynamics, life history and ecology, and potential threat processes affecting this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is used as bait by aboriginal communities in the high Arctic and sometimes taken as bycatch in shrimp fisheries (Roper et al. 2010). Other threats to this species are not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Further research is recommended in order to determine the precise distribution, population dynamics, life history and ecology, and potential threat processes affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gonatus fabricii

Gonatus steenstrupi was for many decades misidentified as G. fabricii.

Gonatus fabricii, the boreoatlantic armhook squid, is a squid in the family Gonatidae. It occurs in the northern Atlantic Ocean from Canada to the Barents Sea.[verification needed]

Until 1981, the name G. fabricii was usually misapplied to the very similar relative G. steenstrupi.

G. fabricii grows to 30 cm in mantle length.[1][verification needed]

The type specimen was collected off Greenland and is deposited at the Zoologisk Museum of Kobenhavns Universitet in Copenhagen.[2]

References

  1. ^ Roper, C.F.E., M.J. Sweeney & C.E. Nauen 1984. Cephalopods of the world. Food and Agriculture Organization, Rome, Italy.
  2. ^ Current Classification of Recent Cephalopoda
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!