Overview

Brief Summary

Introduction

Diagnosis

A Gonatus with ...

  • 3 hooks and one sucker proximal to large central hook on club.
  • 2 large chromatophores on ventral side of head medial to eyes (see title drawing).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Number of suckers in proximal half of each arm IV = 62 at 129 mmGL (neotype), range for all sizes- about 55-69.
  2. Tentacles
    1. Clubs 12-20% of GL (15% in neotype).
    2. Club dactylus with suckers in 7-8 irregular series at base decreasing to 4 sucker series about half way out dactylus; suckers nearly same size in transverse series.
    3. Club ventral-marginal zone with 4 series of suckers in central region; medial suckers ca. one-half diameter of suckers of other three series. Occasionally 1-2 small suckers present as a partial fourth series.
    4. Club dorsal-marginal zone with 3-4 irregular series of suckers.
    5. Club medial zone with large central hook; small distal hook and proximal series with usually 3 small hooks and one sucker, with largest hook never closest to large central hook (i. e., hooks initially increase in size proximally). About a quarter of squid lack sucker, about 10% have 4 hooks and one sucker and about 3% have 2 hooks only.

      Figure. Oral view of the proximal hooks of the medial zone and suckers of the ventral-marginal zone of the club of G. fabricii, fresh. Photograph by M. Vecchione with transmitted light taken aboard the R/V G. O. SARS during the MARECO cruise to the central North Atlantic

    6. Total number of suckers (excluding terminal pad, medial zone) on tentacular club: 155-229.
    7. Median region of tentacular stalk between marginal series with usually 40-80 suckers (range 38-109).

    8. Figure. Oral views of the tentacle and club of G. fabricii 129 mm GL, neotype. Top - Tentacle. Bottom - Enlargement of the tentacular club. Drawings from Kristensen (1981).


      Figure. Oral view of the tentacular club of G. fabricii, fresh. Same club photographed above. Photograph by M. Vecchione.

  3. Head
    1. Radula
      1. All lateral teeth of radula smooth, without ridges.
      2. Figure. Radula of G. fabricii, 106 mm ML. Drawing from Kristensen (1981).

    2. Funnel
      1. Ventral pads of funnel organ about half as long as each rami of dorsal pad.
      2. Figure. Funnel organ of G. fabricii, 129 mmML, neotype. Drawing from Kristensen (1981).

  4. Pigmentation
    1. Two unusually large chromatophores lie deep on the ventral surface of the head.

Comments

The above description, except for photographs, is from Kristensen (1981). More details of the description can be found here.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Canadian part of the Arctic Ocean, Davis Strait, FAO fishing area 18, FAO fishing area 21, Hudson Strait, North West Atlantic, Northern North Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type locality: The neotype was taken at the entrance of Amerdloq Fjord at Holsteinsborg (approximately 67°N, 54°W), West Greeland, 250-285 fms.


Figure. Distribution of Gonatus spp. in the North Atlantic. Blue - G. steenstrupi. Red - G. fabricii. General map with dots and triangles from Kristensen (1981). Red and blue lines based mostly on paralarvae, from Falcon, et al. (2000).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

epi-mesopelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

epipelagic, glacial
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 72 specimens in 1 taxon.
Water temperature and chemistry ranges based on 55 samples.

Environmental ranges
  Depth range (m): 65 - 3321.5
  Temperature range (°C): 0.191 - 13.742
  Nitrate (umol/L): 6.592 - 42.085
  Salinity (PPS): 33.767 - 35.328
  Oxygen (ml/l): 0.584 - 6.972
  Phosphate (umol/l): 0.575 - 3.256
  Silicate (umol/l): 4.311 - 125.886

Graphical representation

Depth range (m): 65 - 3321.5

Temperature range (°C): 0.191 - 13.742

Nitrate (umol/L): 6.592 - 42.085

Salinity (PPS): 33.767 - 35.328

Oxygen (ml/l): 0.584 - 6.972

Phosphate (umol/l): 0.575 - 3.256

Silicate (umol/l): 4.311 - 125.886
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

The mature egg, found in the vicinity of the ovary of a mature female, is nearly spherical and almost 5 mm in the longest axis (Kristensen, 1981). Egg masses have never been observed in nature.

Paralarvae of G. fabricii are most easily separated from the partially sympatric species, G. steenstrupi, by the two large photophores on the ventral surface of the head that distinguish the adults as well. The full chromatophore pattern of the paralarva is not known. The number of suckers on arms I-IV is useful at sizes greater than 13 mm ML as is the form of the funnel organ in all but smallest paralarvae. The paralarval stage appears to end at about 20 mm ML which corresponds with hook development and movement into deeper water (Falcon, et al., 2000).


Figure. Ventral views of growth stages of G. fabricii showing the head chromatophores and the form of the funnel organ. Drawings from Falcon, et al. (2000).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus fabricii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACTTTATCTTTGGTATTTGAGCAGGCCTGCTAGGGACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGGCAACCTGGCTCTTTACTAAACGAC---GATCAACTCTATAATGTTGTAGTTACAGCCCATGGATTTATCATAATTTTTTTTCTAGTAATACCTATTATAATTGGTGGATTTGGTAACTGACTTGTCCCCTTAATATTAGGAGCCCCAGACATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTATTACCCCCTTCCTTAACACTATTGTTAGCTTCCTCAGCCGTTGAAAGAGGGGCAGGGACAGGATGAACAGTGTACCCCCCTCTTTCCAGAAATTTATCTCATGCAGGTCCTTCAGTTGACTTAGCCATTTTTTCTCTACATTTAGCAGGTGTGTCTTCTATTCTAGGGGCCATTAATTTCATTACTACAATTTTAAATATACGATGAGAAGGATTACAAATAGAACGATTACCTCTCTTTGCTTGATCAGTRTTTATTACCGCAATTTTATTACTTCTATCTCTCCCTGTTCTAGCCGGAGCTATTACTATATTATTAACTGATCGAAACTTTAATACAACCTTTTTTGACCCAAGGGGAGGAGGGGATCCTATCTTATACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus fabricii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gonatus fabricii

Gonatus steenstrupi was for many decades misidentified as G. fabricii.

Gonatus fabricii, the boreoatlantic armhook squid, is a squid in the family Gonatidae. It occurs in the northern Atlantic Ocean from Canada to the Barents Sea.[verification needed]

Until 1981, the name G. fabricii was usually misapplied to the very similar relative G. steenstrupi.

G. fabricii grows to 30 cm in mantle length.[1][verification needed]

The type specimen was collected off Greenland and is deposited at the Zoologisk Museum of Kobenhavns Universitet in Copenhagen.[2]

References

  1. ^ Roper, C.F.E., M.J. Sweeney & C.E. Nauen 1984. Cephalopods of the world. Food and Agriculture Organization, Rome, Italy.
  2. ^ Current Classification of Recent Cephalopoda
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!