Overview

Distribution

Range Description

This species occurs in the eastern Pacific between about 28-50ºN (Okutani and Clarke 1992). Its distribution is primarily focussed in the Californian Current region although individuals sometimes appear off Hawaii (Hochberg and Young 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Paratype for Gonatus californiensis Young, 1972
Catalog Number: USNM 727491
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: ; larvae
Preparation: Alcohol (Ethanol)
Year Collected: 1964
Locality: Southern Area, California, United States, North Pacific Ocean
Depth (m): 615 to 615
Vessel: Velero IV R/V
  • Paratype: Young, R. 1972. Smithson. Contrib. Zool. 97: 51-56, pls. 15-17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Gonatids are medium sized oceanic squid that occur over a wide depth range from near the surface to more than 1,000 m in depth (Kubodera et al. 2006). Generally their planktonic paralarvae young are most abundant between 200-300 m in depth, and highest abundances appear to occur over the continental slopes in summer (Okutani and Clarke 1992). Gonatus species attain a maximum mantle length of 400 mm (Kubodera et al. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

meso-bathypelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 615 - 615
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus californiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGTATTTGAGCAGGCCTATTAGGGACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGGCAACCTGGCTCTCTACTAAACGAC---GATCAACTTTACAACGTTGTAGTCACAGCTCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCCTTAATACTAGGAGCCCCAGACATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTACTACCCCCTTCCCTAACACTATTGCTAGCTTCCTCAGCTGTTGAAAGAGGGGCAGGTACAGGATGAACAGTCTACCCCCCTCTTTCTAGTAACTTATCTCATGCAGGGCCTTCTGTTGACTTAGCAABTTTBTCTTTACATTTAGCTGGAGTGTCCTCTATTCTAGGAGCCATTAATBTCATTACKACAATNBBAAATATACGATGAGAAGGTTTACAAATAGAACGATTACCTCTATTTGCTTGATCAGTGTTTATTACTGCAATTTTATTACTGCTATCTCTTCCTGTTCTAGCCGGAGCTATTACTATACTACTAACTGACCGAAACTTTAACACAACCTTTTTTGACCCAAGAGGGGGAGGGGACCCTATCCTATACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus californiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Young, R., Vecchione, M. & Böhm, M.

Contributor/s
Duncan, C. & Carrete-Vega, G.

Justification
Gonatus californiensis is an oceanic species which has been assessed as Least Concern, due to its wide geographic distribution making it less susceptible to human impact. However, further research is recommended in order to determine the precise distribution, population dynamics, life history and ecology, and potential threat processes affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Further research is recommended in order to determine the precise distribution, population dynamics, life history and ecology, and potential threat processes affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!