Physical Description

Type Information

Paratype for Gonatus californiensis Young, 1972
Catalog Number: USNM 727491
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: ; larvae
Preparation: Alcohol (Ethanol)
Year Collected: 1964
Locality: Southern Area, California, United States, North Pacific Ocean
Depth (m): 615 to 615
Vessel: Velero IV R/V
  • Paratype: Young, R. 1972. Smithson. Contrib. Zool. 97: 51-56, pls. 15-17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

meso-bathypelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 615 - 615
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus californiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGTATTTGAGCAGGCCTATTAGGGACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGGCAACCTGGCTCTCTACTAAACGAC---GATCAACTTTACAACGTTGTAGTCACAGCTCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCCTTAATACTAGGAGCCCCAGACATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTACTACCCCCTTCCCTAACACTATTGCTAGCTTCCTCAGCTGTTGAAAGAGGGGCAGGTACAGGATGAACAGTCTACCCCCCTCTTTCTAGTAACTTATCTCATGCAGGGCCTTCTGTTGACTTAGCAABTTTBTCTTTACATTTAGCTGGAGTGTCCTCTATTCTAGGAGCCATTAATBTCATTACKACAATNBBAAATATACGATGAGAAGGTTTACAAATAGAACGATTACCTCTATTTGCTTGATCAGTGTTTATTACTGCAATTTTATTACTGCTATCTCTTCCTGTTCTAGCCGGAGCTATTACTATACTACTAACTGACCGAAACTTTAACACAACCTTTTTTGACCCAAGAGGGGGAGGGGACCCTATCCTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus californiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!