Overview

Brief Summary

Introduction

Gonatus pyros is a small gonatid. A spent female measured 125 mm ML (SBMNH no. 61050). Nesis (1982/87) states that some individuals are known to be up to 160 mm ML. G. pyros is distinctive in being the only gonatid known to possess photophores.

Diagnosis

A Gonatus with ...

  • a large photophore on the ventral surface of each eyeball.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Total of 29-33 hooks and suckers present on proximal half of each arm I-III; squid >34 mm GL with 36-41 suckers on proximal half of each arm IV.
  2. Tentacles
    1. Clubs 20-25% of GL.
    2. Club dactylus with 7-8 irregular series at proximal end, decreasing to 4 series in mid-dactylus.
    3. Club ventral-marginal zone with 3, sometimes 4, series of suckers in central region all nearly same size.
    4. Club dorsal-marginal zone with 3 irregular series dorsal to large central hook.
    5. Club medial zone with large central hook; distal hook present, occasionally joined by an enlarged sucker with a large tooth; proximal series with usually 3-4 small hooks, occasionally preceeded by a series of suckers. Proximal hooks decrease in size toward club base
    6. Total number of suckers (excluding terminal pad and medial zone) on tentacular club: about 151-184.
    7. Median region of tentacular stalk between marginal series with a single, occasionally double and slightly irregular series of sucker adjacent to the ventral-marginal series of the stalk. Lenth variable but usually reaches 3/4 of marginal series length. Medial suckers number between 50-125.




    8. Figure. Oral view of the tentacle of G. pyros. Top - Distal region of tentacle, 35? mm GL. Middle - Enlargement of club from top figure. Drawings from Young (1972). Bottom - Distal region of tentacle, 55 mm ML, preserved. Photograph by R. Young.

  3. Head
    1. Beaks. Descriptions can be found here: Lower beak; upper beak.

  4. Photophores
    1. Large, somewhat oval photophore present on ventral surface of each eye.
    2. Figure. Ventral view of the head and eyes of G. pyros showing ocular photophore. Left - Eyelid folded back to reveal photophore, preserved, 55 mm ML, immature female. Insert - Drawing of eye and photophore from Young (1972). Right - Fresh squid witht the left eye protruding showing the white ocular photophore. Photograph by T. Kubodera. Note the peculiar surface of the photophore which seems to have many small pores.

Comments

More details of the description of G. pyros can be found here.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type locality: 33°37'N, 118°26'W, eastern North Pacific off Southern California. G. pyros is broadly distributed in the central and eastern North Pacific.


Figure. Distribution of G. pyros. Dark region indicates known range; light areas indicate estimated range. Chart modified from Okutani, et al. (1988).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Gonatus pyros Young, 1972
Catalog Number: USNM 727399
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: ; juvenile
Preparation: Alcohol (Ethanol)
Year Collected: 1961
Locality: Southern Area, California, United States, North Pacific Ocean
Depth (m): 667 to 667
Vessel: Velero IV R/V
  • Paratype: Young, R. 1972. Smithson. Contrib. Zool. 97: 43-46, pls. 13,14,17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

epi-mesopelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 563 - 667

Graphical representation

Depth range (m): 563 - 667
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

The size of the juvenile at which the various hooks first develop is often distinctive of the species.

Figure. Chart of the size ranges over which hooks in juveniles of G. pyros first appear. Chart modified from Young (1972).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus pyros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGTATTTGAGCAGGTCTACTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGGCAACCTGGCTCTCTACTAAACGAC---GATCAACTTTATAACGTTGTAGTCACAGCCCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCTTTAATACTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCCCTAACATTATTACTAGCTTCTTCAGCTGTTGAAAGAGGGGCAGGTACAGGATGAACAGTTTACCCTCCTCTCTCTAGTAACCTATCTCATGCAGGCCCTTCAGTTGACTTAGCCATTTTTTCTTTACATTTAGCAGGGGTGTCTTCTATTCTGGGAGCTATTAATTTTATTACTACAATTTTAAATATGCGATGAGAAGGGTTACAAATAGAACGACTACCTCTCTTTGCTTGATCTGTATTTATTACCGCAATTTTATTGCTTCTATCTCTTCCTGTTCTAGCTGGAGCTATTACTATACTATTGACGGACCGAAACTTTAACACAACCTTTTTTGATCCTAGGGGGGGAGGGGACCCTATTTTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus pyros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!