Molecular Biology and Genetics

Molecular Biology

Barcode data: Drosophila sechellia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCGCGACAATGGTTATTTTCTACAAATCATAAAGATATTGGAACTTTATATTTTATCTTTGGAGCCTGAGCTGGAATAGTCGGAACATCATTAAGAATTTTAATTCGAGCCGAATTAGGTCACCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGAAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTGCTCTTTCTTTATTATTAGTAAGAAGAATAGTTGAAAACGGAGCTGGAACAGGATGAACTGTTTATCCACCTTTATCTGCTGGAATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTCTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATTTCATTAGATCGTATACCTTTATTTGTTTGATCAGTAGTTATTACTGCCTTATTATTACTGTTATCATTGCCAGTATTAGCGGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTAGACAAGAATCGGGAAAAAAGGAAACTTTTGGTTCTTTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACAGTAGGAATAGACGTAGATACACGAGCTTATTTCACTTCAGCTACTATAATTATTGCAGTTCCTACTGGTATTAAAATTTTTAGCTGATTAGCTACTTTACATGGAACTCAACTTTCTTATTCTCCAGCTATTTTATGAGCTTTAGGATTTGTATTTTTATTCACAGTAGGAGGATTAACAGGAGTTGTTTTAGCTAATTCATCAGTAGATATCATTTTACATGATACTTATTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGCAGGTTTTATTCATTGATACCCTTTATTTACTGGATTAACATTAAATAATAAATGATTAAAAAGTCAATTTATTACTATATTTATTGGAGTAAATTTAACATTTTTCCCTCAACATTTTTTAGGATTAGCTGGGATACCTCGACGATATTCAGATTATCCAGATGCTTACACAACATGAAATATTGTGTCTACTATTGGATCAACTATTTCATTATTAGGAATTCTATTCTTTTTTTTTATTATTTGAGAAAGTTTAGTATCACAACGGCAAGTAATTTACCCAATTCAATTAAATTCATCTATTGAATGATACCAAAATACTCCCCCAGCTGAACATAGATATTCTGAATTACCACTATTAACAAATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila sechellia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Drosophila sechellia

Drosophila sechellia is a species of fruit fly, used in lab studies of speciation because can mate with Drosophila simulans.

Drosophila sechellia is endemic to (some of) the Seychelles, and was one of 12 fruit fly genomes sequenced for a large comparative study. [1]

References[edit]

  1. ^ Drosophila 12 Genomes Consortium; et al. (2007). "Evolution of genes and genomes on the Drosophila phylogeny". Nature 450 (7167): 203–218. doi:10.1038/nature06341. PMID 17994087. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!