Overview

Comprehensive Description

General Description

A medium-size (approx.4.0 cm wingspan robust olive grey-green and black moth that flies in early spring. The basal and terminal areas of the forewings are lighter olive green, with smaller patches along the costa, around the orbicular and reniform spots, with the remainder suffused with black. The amount of black varies considerable, and the illustrated specimen (from Redwater) is about average. The hindwings are dark grey, usually with pale olive in the disc and on the lower margin. The fringes are checkered. The thorax and abdomen are olive and black. Sexes similar, except male antennae bipectinate, female simple. The other two Alberta species of Feralia are more common and widespread. F. comstocki is paler green with greatly reduced dark areas and lighter hindwings; F. jocosa is smaller with darker hindwings, and usually lacks the extensive dark suffusion on the forewings.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Feralia major was described from New York State, and occurs from the northeastern USA west across the southern boreal forest to western Alberta. The southern limits of distribution are uncertain, as populations from the southeastern USA south to Texas are brighter blue-green and based on bar-coded specimens appear to be a separate species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Lectotype for Feralia major Smith, 1890
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: male;
Preparation: Pinned
Locality: District of Columbia, United States
  • Lectotype: Smith. 1890. Entomologica Americana. 6: 26.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Major occurs in coniferous forest, in particular where there are pines.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larvae are solitary defoliators of conifers, including spruce and pines.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

In Alberta the adults fly in mid to late April.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Like other Feralia species, the life history is probably closely linked to the appearance of new buds on the host conifers. Adults emerge early in the spring and lay eggs which hatch about the time the bud scales drop off the new buds. The larvae feed on the soft new needles until they harden, then pupate. They complete much of their transformation in the pupae before winter, and thus are ready to emerge as soon as it warms in spring. They are nocturnal and come to light.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Feralia major

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTTGTTCCCTTAATATTAGGTGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCTTTAACCCTTCTTATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTATCATCAAATATCGCCCACGGAGGAAGTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGGATTACTGCATTTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGTAATTTAAATACATCATTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Feralia major

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Feralia major

The Major Sallow (Feralia major) is a species of moth of the Noctuidae family. It is found from the northeastern parts of the United States west across the southern boreal forest to western Alberta. The exact southern range is uncertain, as populations from the southeastern USA south to Texas are brighter blue-green and appear to be a separate species.

Feralia major hampson.JPG

The wingspan is about 40 mm. The moth flies in April depending on the location.

The larvae feed on pinus species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: There is a slight chance that there are two species and there are minor races. For example the isolated southern New Jersey version is 100% of the dark form which occurs as a polymorphism northward. Specimens matching these occasionally are collected farther south but at least in South Carolina and Gerogia most to all are a brilliant green form brighter than any up north and these populations fly over the winter (starting in December) while from Virginia northward the species flies in early spring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!