Overview

Comprehensive Description

General Description

A large (4.0-5.0 cm wingspan) heavy-bodied grey moth. The body is slate grey or blackish. Forewings are dark grey or black over the basal half, shading to lighter grey on the outer half, and are crossed by a network of fine broken black lines. The hindwings are thinly scaled and somewhat translucent white, with a very fine network of indistinct dark lines and a narrow black terminal line. Antennae are narrowly bipectinate in males, finely serrate in females. Sexes similar except for size, with females larger than males. The two-tone forewing with dark basal half and the pale hindwings will separate the Poplar Carpenterworm from the similar Carpenterworm (P. robiniae) and Aspen Carpenterworm (A. populi).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern North America, west to central Alberta. In Alberta, they have been collected along the southern edge of the Boreal forest (Lac la Biche, Redwater and Edmonton areas) and in the Aspen Parkland (Altario).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Mature woodland with poplar, in particular Trembling aspen.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The only Alberta data is for an adult reared at Altario from a larva in an aspen poplar (Populus tremuloides) log split for firewood. They probably also utilizes other poplar species as well.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults have been collected in Alberta from mid-June through early August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The larvae are borers that live in galleries they create in the trunks and stems of poplar trees, where they feed on the cambium area. Mature larvae are 4-5 cm long, creamy white with brown spots at the base of the setae, and dark brown heads and thoracic shields. Little is known about the life cycle, but the closely related Carpenterworm takes up to three or four years to complete the life cycle, and it is probable that the Poplar Carpenterwom also takes several years to mature. The adults come to light. Larvae are occasionally been found when splitting aspen logs for firewood. Their boring can weaken trees, making them more vulnerable to wind damage and drought, but they are not abundant enough to be a serious problem.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acossus centerensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGATCTGGAATAGTGGGAACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCTCTAATTGGGAATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCTCTAATATTAGGAGCCCCTGATATAGCTTTCCCACGGATAAACAACATAAGATTTTGATTATTACCCCCATCATTAACCCTTTTAATTTCTAGAAGTATTATTGAAAATGGAGCCGGCACAGGATGAACTGTCTATCCCCCTTTATCATCTAATATTTCCCACGGAGGAAGATCAGTTGATTTAACGATTTTCTCCTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTCATTACAACAATTATTAATATACGACCTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACTGCTTTACTACTTCTGCTTTCATTACCCGTTTTAGCTGGAGCAATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGANCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acossus centerensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

At the northwestern edge of it's range in Alberta; no concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acossus centerensis

The Poplar Carpenterworm (Acossus centerensis) is a moth of the Cossidae family. [1] It is found from New Jersey west to Illinois and North Dakota. In Canada it is found from Quebec and Ontario west to British Columbia.

The wingspan is 40-50 mm for males and 50-64 mm for females.

The larvae feed on Populus species, mainly Populus tremuloides, but also Balsam poplars.

References[edit]

  1. ^ Markku Savela (September 15, 2005). "Acossus genus". funet.fi. Retrieved 2009-03-11. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!