Overview

Brief Summary

The Northern Fowl Mite (Ornithonyssus sylviarum) is a common external parasite of both domestic fowl and wild birds throughout the temperate regions of the world. It has been shown to produce economic damage by causing anemia, lowering egg production (as much as 10% in healthy chickens) and weight gain, and even causing bird death. Although moderate infestations do not affect egg production, the mites will also bite humans, causing itching and skin irritation.

The adult female Northern Fowl Mite lays eggs on its bird host. Depending on the temperature and humidity, the eggs will hatch in 1 to 2 days. The larvae that hatch from the egg do not feed, but molt to the nymphal stage in around eight hours. The nymph has biting mouthparts and pierces the host bird's skin for a blood meal. The nymphs mature to adults in 4 to 7 days.

The adult female mites take a blood meal and complete egg laying in two days. The number of eggs laid averages only 2 to 5 per female mite. The complete life cycle from egg to egg-laying adult can be completed in 5 to 7 days or longer, depending on temperature and humidity. Adult Northern Fowl Mites spend most of their lives on the host, but will also wander. The preferred sites on the host are the vicinity of the vent (cloacal opening) and on the back.

Although the female mites do not lay large numbers of eggs, mite populations can nevertheless increase rapidly once a bird has been infested. Under optimal (for the mites!) conditions, newly-infested chickens can support mite populations in excess of 20,000 per bird in 9 to 10 weeks. Mite populations of approximately 200,000 per bird may cause death from blood loss.

The Northern Fowl Mite is very similar to the Tropical Fowl Mite (Ornithonyssus bursa), but can be distinguished by the dorsal plate. The posterior end of this plate tapers acutely in the Northern Fowl Mite but more evenly in the Tropical Fowl Mite. Furthermore, three pairs of setae (bristles) are present on the sternal plate in Tropical Fowl Mites but only two pairs in Northern Fowl Mites (see illustrations in online Featured Creatures species account by Denmark and Cromroy (2012)).

(Kaufman et al. 2007)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

The Northern Fowl Mite (Ornithonyssus sylviarum) is very similar to the Tropical Fowl Mite (Ornithonyssus bursa), but can be distinguished by the dorsal plate. The posterior end of this plate tapers acutely in the Northern Fowl Mite but more evenly in the Tropical Fowl Mite. Furthermore, three pairs of setae (bristles) are present on the sternal plate in Tropical Fowl Mites but only two pairs in Northern Fowl Mites (see illustrations in online Featured Creatures species account by Denmark and Cromroy (2012)).

(Kaufman et al. 2007)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ornithonyssus sylviarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTTCACATAGAGGTAAATCAGTTGATCTA---GCTATTTTTAGACTTCATATTGCTGGTATTTCTTCTATTTTAGGCTCTATTAATTTTATTACAACAATTTGTAATATACGTCCTAAATCTATATCAATAGAACATATACCACTTTTTATTTGATCTGTTCTAATTACAACTATTCTTCTTCTTCTTTCTTTACCAGTTTTAGCTGGA---GCTATTACCATATTATTATCAGACCGAAATTTTAATACCTCATTTTTTGATCCTAGTGGAGGAGGAGATCCTATTTTATATCAACACCTTTTTTGATTTTTTGGACACCCTGAAGTATATATTCTTATTCTCCCAGGATTTGGGATTATTTCTCAAATCATTTGTTTTCAAACTAACAAAAAA---CAACCTTTTGGTAATCTAGGTATAATTTATGCTATACTTAGAATTGGTATTCTAGGATTTATTGTTTGAGCCCATCATATATTTACTGTTGGTCTTGACATTGATACACGAGCCTATTTTACTACAGCTACAATAATC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ornithonyssus sylviarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!