Overview

Distribution

French Polynesian Exclusive Economic Zone, Mayotte Exclusive Economic Zone, New Caledonian Exclusive Economic Zone, Réunion Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 5
  Temperature range (°C): 25.282 - 27.493
  Nitrate (umol/L): 0.134 - 0.348
  Salinity (PPS): 34.308 - 35.368
  Oxygen (ml/l): 4.561 - 4.753
  Phosphate (umol/l): 0.098 - 0.175
  Silicate (umol/l): 1.291 - 2.177

Graphical representation

Depth range (m): 0.5 - 5

Temperature range (°C): 25.282 - 27.493

Nitrate (umol/L): 0.134 - 0.348

Salinity (PPS): 34.308 - 35.368

Oxygen (ml/l): 4.561 - 4.753

Phosphate (umol/l): 0.098 - 0.175

Silicate (umol/l): 1.291 - 2.177
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonodactylus platysoma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTCATTTTAGGAGCTTGATCAGGAATAGTAGGTACAGCCCTTAGACTAATTATTCGAGCAGAACTTGGTCAACCAGGAAGTTTGATTGGAGAT---GATCAAATTTACAATGTTGTAGTTACAGCCCATGCTTTTATTATGATTTTCTTTATAGTTATGCCCATTATAATTGGGGGATTCGGTAATTGACTAGTACCTCTTATATTAGGCGCCCCAGATATAGCATTCCCACGAATAAACAATATAAGGTTCTGACTACTCCCTCCCGCTCTTACTCTTTTACTCTCAAGAGGTATAGTAGAAAGAGGGGTAGGGACTGGATGAACTGTTTATCCTCCTCTTGCTGCTGGTATTGCTCACGCAGGAGCCTCTGTAGATTTGGGTATCTTTTCTTTACATATAGCAGGAGCTTCCTCAATTTTAGGAGCGGTAAACTTTATTACTACAGTTATCAATATACGATCTAATGGGATAACTATAGACCGTATACCTCTTTTCGTATGAGCAGTTTTTATTACAGCTATTTTACTTTTATTATCTCTTCCTGTACTAGCAGGAGCCATTACCATGTTATTGACGGACCGTAACTTAAATACGTCATTCTTTGATCCTGCTGGAGGGGGAGATCCTGTTCTTTACCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonodactylus platysoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!