Overview
Distribution
French Polynesian Exclusive Economic Zone, Mayotte Exclusive Economic Zone, New Caledonian Exclusive Economic Zone, Réunion Exclusive Economic Zone
-
Poupin, J., 2010. - Biodiversité de l’Indo-Pacifique tropical français : 2514 espèces de crustacés décapodes et stomatopodes. Rapport scientifique de l'Institut de Recherche de l'Ecole Navale, Octobre 2010, 76 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=147708
Trusted
Ecology
Habitat
Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 0.5 - 5
Temperature range (°C): 25.282 - 27.493
Nitrate (umol/L): 0.134 - 0.348
Salinity (PPS): 34.308 - 35.368
Oxygen (ml/l): 4.561 - 4.753
Phosphate (umol/l): 0.098 - 0.175
Silicate (umol/l): 1.291 - 2.177
Graphical representation
Depth range (m): 0.5 - 5
Temperature range (°C): 25.282 - 27.493
Nitrate (umol/L): 0.134 - 0.348
Salinity (PPS): 34.308 - 35.368
Oxygen (ml/l): 4.561 - 4.753
Phosphate (umol/l): 0.098 - 0.175
Silicate (umol/l): 1.291 - 2.177
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 0.5 - 5
Temperature range (°C): 25.282 - 27.493
Nitrate (umol/L): 0.134 - 0.348
Salinity (PPS): 34.308 - 35.368
Oxygen (ml/l): 4.561 - 4.753
Phosphate (umol/l): 0.098 - 0.175
Silicate (umol/l): 1.291 - 2.177
Graphical representation
Depth range (m): 0.5 - 5
Temperature range (°C): 25.282 - 27.493
Nitrate (umol/L): 0.134 - 0.348
Salinity (PPS): 34.308 - 35.368
Oxygen (ml/l): 4.561 - 4.753
Phosphate (umol/l): 0.098 - 0.175
Silicate (umol/l): 1.291 - 2.177
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gonodactylus platysoma
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTATATTTCATTTTAGGAGCTTGATCAGGAATAGTAGGTACAGCCCTTAGACTAATTATTCGAGCAGAACTTGGTCAACCAGGAAGTTTGATTGGAGAT---GATCAAATTTACAATGTTGTAGTTACAGCCCATGCTTTTATTATGATTTTCTTTATAGTTATGCCCATTATAATTGGGGGATTCGGTAATTGACTAGTACCTCTTATATTAGGCGCCCCAGATATAGCATTCCCACGAATAAACAATATAAGGTTCTGACTACTCCCTCCCGCTCTTACTCTTTTACTCTCAAGAGGTATAGTAGAAAGAGGGGTAGGGACTGGATGAACTGTTTATCCTCCTCTTGCTGCTGGTATTGCTCACGCAGGAGCCTCTGTAGATTTGGGTATCTTTTCTTTACATATAGCAGGAGCTTCCTCAATTTTAGGAGCGGTAAACTTTATTACTACAGTTATCAATATACGATCTAATGGGATAACTATAGACCGTATACCTCTTTTCGTATGAGCAGTTTTTATTACAGCTATTTTACTTTTATTATCTCTTCCTGTACTAGCAGGAGCCATTACCATGTTATTGACGGACCGTAACTTAAATACGTCATTCTTTGATCCTGCTGGAGGGGGAGATCCTGTTCTTTACCAACAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Gonodactylus platysoma
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
