Overview

Distribution

In 1997, a single male mitten crab was collected from the Columbia River, near Astoria, Oregon and later confirmed (Jensen and Armstrong, 2004). Since then, other sightings have been reported, but no additional specimens have been collected.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Frey, Melissa

Source: Marine Invaders of the NE Pacific

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eriocheir japonica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 40 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAACGATGACTTTTTTCCACAAATCATAAAGATATTGGACCATTATATTTTATTTTTGGTGCTTGAGCCGGAATAGTAGGAACATCATTA---AGATTAATTATTCGAGCTGAATTAAGACAACCAGGTAGACTAATTGGTAAT---GACCAAATTTATAACGTAGTTGTAACAGCCCACGCTTTTGTAATAATTTTTTTTATAGTAATACCCATTATAATTGGTGGATTTGGTAATTGACTTGTTCCTCTTATA---CTAGGAGCCCCAGATATAGCTTTCCCACGAATAAACAATATAAGATTCTGACTTCTACCACCTTCTCTCTCTCTTTTACTTACAAGAAGAATAGTAGAAAGAGGAGTTGGTACGGGATGAACTGTCTACCCACCTTTAGCAGCAGCCATCGCTCATGCTGGGGCATCAGTTGATCTTGGT---ATCTTTTCTCTACATCTTGCCGGAGTTTCCTCAATTTTAGGAGCTGTTAATTTCATAACAACAGTTATTAATATACGATCATATGGTATAACAATAGATCAAATACCTCTTTTTGTTTGAGCTGTATTTATTACTGCTATTTTGCTTCTTTTGTCTCTTCCAGTTTTAGCTGGA---GCTATTACTATACTGCTTACAGATCGTAACCTAAATACGTCATTTTTCGATCCTGCAGGAGGAGGTGACCCAGTTCTATACCAGCACTTATTCTGATTTTTCGGTCACCCAGAAGTCTATATTCTAATTTTACCTGCCTTCGGTATAATTTCTCATATTGTAAGTCAGGAATCAGGTAAAAAG---GAATCTTTTGGAACTCTAGGTATAATTTACGCTATATTAGCTATTGGAATTTTAGGCTTTGTAGTATGAGCTCACCATATATTTACAGTGGGAATAGACGTAGACACTCGAGCTTACTTTACCTCCGCCACTATAATTATTGCTATCCCTACAGGAATTAAAATCTTTAGATGGCTAAGA---ACCTTACATGGAACT---CAAATAAATTATTCGCCATCTCTTCTATGAGCTTTAGGGTTTATCTTTTTATTTACTATTGGAGGTCTAACAGGAGTAGTTTTAGCTAATTCTTCAATTGATATTATTCTCCATGATACTTATTATGTTGTCGCCCACTTTCATTATGTA---CTCTCTATAGGAGCAGTTTTCGGAATCTTTGCTGGAGTTGCTCACTGATTTTCTCTAATGACAGGTTTATCTTTCAACCCTAAATGACTAAAAATTCACTTTTTAGTAACTTTCGTAGGAGTTAATTTAACTTTTTTTCCCCAACACTTCTTAGGATTAAACGGTATACCACGA---CGGTACTCTGATTATCCTGATGCCTATGCA---ACTTGAAATATTGTATCATCTATGGGTTCTATAATTTCCTTTGTAGCCGCATTAGGATTCTTATTAATCGTTTGAGAAGCATTTGTTTCTAATCGCCCAGTT---ATCTTTTCTCCTTTTCTGCCCTCTTCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eriocheir japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Eriocheir rectus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATAGTAGGAACATCTTTAAGATTAATTATTCGAGCTGAATTAAGACAGCCAGGCAGGTTAATTGGTAAC---GATCAAATTTATAATGTAGTTGTTACAGCCCACGCTTTCGTAATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGACTTGTTCCTCTTATATTAGGTGCCCCTGATATAGCATTCCCCCGTATAAACAATATAAGATTTTGGCTTTTACCTCCTTCACTCTCTCTTTTACTTACAAGAAGAATAGTAGAAAGGGGAGTTGGAACAGGATGGACCGTTTATCCTCCTCTGGCAGCGGCTATTGCCCATGCTGGGGCCTCGGTTGACCTGGGAATTTTTTCTCTTCATCTTGCTGGGGTCTCTTCAATTCTAGGGGCCGTGAACTTTATAACAACAGTTATTAACATACGATCATACGGCATAACAATAGACCAAATACCTCTTTTTGTTTGAGCTGTTTTTATTACTGCTATTTTGCTTCTTCTATCTCTTCCCGTCTTAGCTGGCGCTATTACTATACTTCTTACAGACCGTAACTTAAATACATCATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eriocheir rectus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Eriocheir formosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTGTTTTTGGTGCCTGAGCTGGAATAGTAGGAACATCTTTA---AGATTAATTATTCGAGCTGAATTAAGACAGCCAGGCAGGTTAATTGGTAAC---GATCAAATTTATAATGTAGTTGTTACAGCCCACGCTTTCGTAATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGACTTGTTCCTCTTATA---TTAGGTGCCCCTGATATAGCATTCCCCCGTATAAACAATATAAGATTTTGGCTTTTACCTCCTTCACTCTCTCTTTTACTTACAAGAAGAATAGTAGAAAGGGGAGTTGGAACAGGATGGACCGTTTATCCTCCTCTGGCAGCGGCTATTGCCCATGCTGGGGCCTCGGTTGACCTGGGA---ATTTTTTCTCTTCATCTTGCTGGGGTCTCTTCAATTCTAGGGGCCGTGAACTTTATAACAACAGTTATTAACATACGATCATACGGCATAACAATAGACCAAATACCTCTTTTTGTTTGAGCTGTTTTTATTACTGCTATTTTGCTTCTTCTATCTCTTCCCGTCTTAGCTGGC---GCTATTACTATACTTCTTACAGACCGTAACTTAAATACATCATTCTTCGATCCAGCTGGAGGTGGTGATCCTGTCCTTTATCAACACTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eriocheir formosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Molecular research suggests that the subfamily Varuninae be elevated to family (Schubart et al. 2000, 2002). McLaughlin et al. (2005) recognize the elevation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!