Overview

Comprehensive Description

Color

Base colour white. Pereopods with transverse red and white bands. Carapace with diffuse orange-red markings, darkest on peaks of transverse ridges.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Etymology

From the Latin procerus, slender, alluding to the very slender chelipeds that distinguish the species from A. soelae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type locality

Eastern Australia, the Lord Howe Rise, and New Caledonia; 450–960 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Data

Holotype, female, AM P25095.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymy

Agononida soelae. — Macpherson, 1994: 530 (New Caledonia, 530–650 m) (not A. soelae (Baba, 1986)).
Agononida procera Ahyong & Poore, 2004b: 10, fig. 1 (Queensland and New South Wales, 675–824 m). — Poore, 2004: 231, fig. 63c (compilation). — Baba, 2005: 236 (key, synonymies). — Ahyong, 2007: 13, fig. 6E (Lord Howe Rise, 565–960 m).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Australia, the Lord Howe Rise, and New Caledonia; 450–960 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Caledonian Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Females 14.3–21.4 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Ahyong, Shane

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 530 - 823
  Temperature range (°C): 6.112 - 11.203
  Nitrate (umol/L): 16.494 - 34.602
  Salinity (PPS): 34.399 - 34.913
  Oxygen (ml/l): 2.153 - 4.573
  Phosphate (umol/l): 1.249 - 2.494
  Silicate (umol/l): 8.791 - 73.996

Graphical representation

Depth range (m): 530 - 823

Temperature range (°C): 6.112 - 11.203

Nitrate (umol/L): 16.494 - 34.602

Salinity (PPS): 34.399 - 34.913

Oxygen (ml/l): 2.153 - 4.573

Phosphate (umol/l): 1.249 - 2.494

Silicate (umol/l): 8.791 - 73.996
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agononida procera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTACTTCATTTTCGGGGCATGAGCTGGTATAGTCGGCACATCCCTAAGCTTAATCATTCGAGCTGAATTAGGCCAACCAGGAAGTTTAATTGGAGAT---GATCAAATCTATAATGTTATTGTTACAGCACACGCCTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGGTTCGGAAATTGGTTAGTCCCCCTTATACTAGGCTCCCCAGATATGGCATTCCCGCGGATAAATAACATAAGCTTCTGATTACTACCACCATCTTTAACCCTCCTTCTCATAAGAGGAATAGTAGAAAGAGGGGTGGGAACCGGATGAACTGTTTACCCACCTCTTGCTGCAGGTATCGCACACGCTGGAGCCTCTGTAGATATAGGAATCTTCTCTTTACATTTAGCAGGGGTTTCCTCCATCTTAGGAGCAGTAAACTTCATAACCACAGTGATCAATATACGACCTGCAGGAATAACCATAGACCGAATACCTCTTTTCGTTTGATCTGTTTTTATTACAGCAGTTTTATTACTTCTTTCTTTACCAGTTCTCGCCGGGGCTATCACCATACTACTTACAGATCGAAATTTAAACACCTCTTTTTTCGATCCTGCAGGAGGGGGAGATCCTATCCTCTACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Agononida procera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!