Ecology

Habitat

Marine, soft bottom.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 7660 - 7660
  Temperature range (°C): 1.077 - 1.077
  Nitrate (umol/L): 33.189 - 33.189
  Salinity (PPS): 34.702 - 34.702
  Oxygen (ml/l): 4.756 - 4.756
  Phosphate (umol/l): 2.314 - 2.314
  Silicate (umol/l): 125.619 - 125.619
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

Lower abyssal to hadal (4000 to below 7000 m), 0 to 9200 m.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hirondellea dubia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGTTCTAATCATAAGGATATTGGCACCCTTTATTTTATTCTAGGCGCTTGAGCAAGAGCTGTAGGTACTTCCCTAAGCCTAATCATTCGGTCTGAGCTAAGAGCCCCAGGCTGCTTAATTGGAGAT---GACCAAGTATACAACACCTTAGTTACAGCTCATGCTTTTGTAATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGTAACTGACTTGTCCCCTTAATACTAGGAAGACCAGATATGGCTTTCCCTCGTATAAATAATATAAGATTCTGATTACTCCCTCCTTCCTTAACACTTCTCTTAATAAGAGGGCTTGTAGAAAGAGGAGTAGGAACAGGCTGAACTGTTTATCCCCCCCTAGCTGCCGAAGCAGCTCACAGAGGAGGCTCTGTAGATCTAGCTATTTTTTCATTACACCTAGCAGGTGCTTCTTCTATCCTAGGTGCAATCAACTTTATCTCCACAATTATCAATATACGAAGACCCGAAATACTTATAGACCAAATTCCTTTATTTGTCTGATCAGTATTTATCACAGCTATTCTTCTCCTTCTTTCCATACCTGTGCTTGCAGGAGCAATCACAATACTCCTAACTGACCGAAATATTAATACCTCTTTTTTTGATCCTAGGGGAGGAGGAGATCCTATCCTCTATCAACACCTTTTTTGYTTTTTTGGTCATCCTGAAGTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hirondellea dubia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!