Overview
Distribution
Greek Exclusive Economic Zone
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gammarus roeseli
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CTAAGACTAATTATCCGGTCAGAGCTCAACACACCTGGTAATCTAATTGAAGAT---GACCAACTATATAATGTAATAGTTACAGCCCATGCTTTCGTTATAATTTTCTTTATAGTTATACCAATCATAATCGGGGGATTTGGCAACTGACTAGTGCCATTGATA---TTGGGTAGCCCTGATATAGCCTTTCCACGTATAAATAATATAAGATTTTGGCTGTTACCCCCTTCTCTTTCTTTACTCTTACTGAGCGGGTTAGTCGAAAGTGGAGTGGGTACGGGGTGAACAGTTTATCCACCATTAGCCGGAGCTACAGCTCACAGTGGTAGGGCTGTAGACTTA---GCTATTTTCTCACTTCATTTAGCTGGAGCTTCATCTATCCTGGGGGCTATCAATTTCATCTCTACAATTATCAATATACGGAGGCCAGGTATACCCTTTGACCAGGTTCCTTTATTTGTTTGGTCTGTGTTTATCACGGCCTTTTTACTTCTATTATCATTGCCAGTTTTAGCCGGA---GCTATCACTATACTCTTACTAGACCGAAATCTTAATACCTCTTTTTTCGACCCTTCCGGGGGTGGAGACCCTATTCTGTACCAGCATTTATTCTGGTTCTTCGGCCACCC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Gammarus roeseli
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Gammarus roeseli
Gammarus roeseli is a species of freshwater amphipod found across Europe from the Benelux countries to European Turkey.[1] It spread from the Balkans northwards, via the Danube system to establish itself as an alien species in Poland, although it is not an invasive species.[2]
References
- ^ a b "Gammarus roeseli Gervais 1835". Fauna Europaea. 2007-05-04. http://www.faunaeur.org/full_results.php?id=240817.
- ^ Michał Grabowski, Krzysztof Jażdżewski & Alicja Konopacka (2007). "Alien Crustacea in Polish waters – Amphipoda" (PDF). Aquatic Invasions 2 (1): 25–38. doi:10.3391/ai.2007.2.1.3. http://www.aquaticinvasions.ru/2007/AI_2007_2_1_Grabowski_etal.pdf.
 | This amphipod article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
