Ecology
Habitat
Depth range based on 3165 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2973 samples.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Graphical representation
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2973 samples.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Graphical representation
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth range based on 3165 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2973 samples.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Graphical representation
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2973 samples.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Graphical representation
Temperature range (°C): -0.849 - 29.546
Nitrate (umol/L): 0.008 - 26.054
Salinity (PPS): 30.381 - 37.431
Oxygen (ml/l): 4.467 - 8.078
Phosphate (umol/l): 0.036 - 1.743
Silicate (umol/l): 0.464 - 37.572
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Physeter catodon
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATGTTCATAAACCGCTGATTATTCTCAACCAACCATAAGGACATCGGCACTCTATATCTACTATTCGGTGCCTGAGCGGGAATGGTGGGCACTGGCCTAAGCTTGCTAATCCGCACCGAGTTAGGCCAACCCGGTACATTAATTGGGGATGACCAAGTCTACAACGTGCTGGTAACAGCTCACGCCTTTGTGATAATTTTCTTCATAGTCATACCCATCATAATTGGCGGTTTCGGAAACTGATTAGTTCCTCTAATAATCGGAGCACCTGACATAGCCTTTCCTCGTATAAATAACATGAGCTTCTGACTACTCCCCCCTTCATTCCTACTACTAATAGCTTCTTCAATAGTCGAAGCCGGCGCAGGTACAGGCTGGACTGTTTACCCCCCTCTAGCCGGAAATTTAGCACATGCAGGAGCATCCGTAGACCTTACCATCTTTTCCCTACACCTAGCTGGTGTCTCCTCAATCCTTGGAGCCATCAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCATAACTCAATACCAAACACCTCTCTTCGTATGATCTATTTTAGTCACGGCTGTATTGCTCCTCCTATCCCTACCAGTCTTAGCAGCTGGAATCACCATACTGTTAACCGACCGAAACCTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGACCCTGTTTTGTATCAACACTTATTCTGATTCTTCGGTCACCCTGAGGTCTATATTCTAATCCTACCTGGCTTCGGAATAATCTCCCACATCGTAACTTATTATTCCGGGAAAAAAGAGCCCTTTGGATATATGGGAATAGTCTGGGCTATAATCTCTATTGGATTCTTAGGCTTTATCGTATGAGCCCACCACATATTCACTGTAGGTATGGATGTTGACACACGAGCATACTTTACATCCGTAACTATAATCATTGCCATCCCTACAGGAGTAAAAATCTTCAGCTGACTGGCAACCCTCCATGGAGGCAACATTAAATGATCTCCCGCCCTAATATGAGCCTTAGGCTTCATTTTTCTCTTTACAGTAGGTGGCTTGACTGGTATTGTCCTAGCCAACTCTTCACTAGATGTCGTCCTTCACGATACATACTATGTAGTCGCCCACTTCCACTACGTTCTTTCAATAGGAGCTGTTTTTGCCATCATAGGAGGTTTCGTTCACTGATTCCCATTATTCTCAGGATATACACTTGACCCCACATGAGCAAAAATCCATTTCCTCATCATATTTGTAGGCGTAAACCTGACATTCTTCCCTCAACATTTCCTAGGCCTATCAGGCATGCCTCGACGATACTCGGACTATCCAGACGCCTATACAACATGAAACACAGTCTCATCAATAGGCTCATTCATCTCACTAACAGCAGTTATACTGATAATCTTCATTATCTGAGAAGCCTTCGCATCCAAACGAGAAGTAACATCAATACATCTTACCTCTACCAACCTCGAATGACTAAATGGGTGCCCTCCACCATATCACACATTCGAAGAACCTGTATACATCAATCCAAAATGATCAAGA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Physeter catodon
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 5 | Public Records: | 2 |
| Specimens with Sequences: | 3 | Public Species: | 1 |
| Specimens with Barcodes: | 3 | Public BINs: | 1 |
| Species: | 2 | ||
| Species With Barcodes: | 2 | ||
Trusted
Barcode data
Trusted
Locations of barcode samples
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
