Overview

Comprehensive Description

Biology

The most widespread Arctic krill
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transparent, yellowish if rich in lipids, females might develop blue hue when spawning; Eyes round, rostrum pointed, photophores red; Anntennae lack lappet, carapace with 1 small denticle; abdomen without keel-spines
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

depth in m: 0-200; horizontal distribution: amphiboreal species, N Atlantic, N Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Gulf of Maine
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphiboreal species; found in the Barents Sea, White Sea, Kara Sea, Bering Sea, Sea of Okhotsk, Chukchi Sea.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The lateral edges of the carapace carry a small spine on each side. The last segment of the abdomen does not carry a spine.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length up to 30 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from other Thysanoessa species by the presence of 2 spines on the sides of the carapace

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

upper and glacial of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 898 specimens in 1 taxon.
Water temperature and chemistry ranges based on 702 samples.

Environmental ranges
  Depth range (m): 0 - 500
  Temperature range (°C): -1.497 - 9.346
  Nitrate (umol/L): 0.367 - 37.013
  Salinity (PPS): 25.730 - 34.928
  Oxygen (ml/l): 2.991 - 9.319
  Phosphate (umol/l): 0.048 - 2.910
  Silicate (umol/l): 2.330 - 90.291

Graphical representation

Depth range (m): 0 - 500

Temperature range (°C): -1.497 - 9.346

Nitrate (umol/L): 0.367 - 37.013

Salinity (PPS): 25.730 - 34.928

Oxygen (ml/l): 2.991 - 9.319

Phosphate (umol/l): 0.048 - 2.910

Silicate (umol/l): 2.330 - 90.291
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Panarctic and subarctic in coastal waters (above 200m); Can be abundant in coastal embayments; Most common in Arctic waters near Pacific or Atlantic inflows, uncommon in central basins; Undergo diel vertical migrations, spending daytime near bottom, night-time in surface waters
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Primarily herbivourous, may feed on detritous when food is scarse - known to feed directly on under-ice algae; During open-water periods feed on phytoplankton when abundant (shifting to small zooplankton when phyoplankton less abundant); An important prey item for fish, birds, seals and whales
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females lay several clutches of eggs during summer; Females require repeated mating after each molt to form new egg clutches; Life cycles is typcial: eggs, nauplius, metanauplius, followed by several stages of feeding calytopsis, and furcillia larvae; Juveniles resemble adults, and molt regularly while growing to adulthood over the first year of life; Life expectancy not known, likely 2-3 years
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thysanoessa raschii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACACTATATTTTATCTTTGGTGCATGAGCTGGGATAGTAGGTACTTCACTAAGATTAATTATTCGAGCTGAATTGGGTCAACCAGGAAGGCTTATTGGGGATGACCAAATTTATAATGTTGTAGTCACAGCTCACGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATTATAATTGGTGGATTTGGTAATTGACTAGTTCCTCTTATACTAGGAGCACCAGATATAGCTTTTCCTCGTATAAATAATATAAGGTTTTGATTATTACCTCCCTCTTTAACTCTTTTACTAGGTAGTGGGCTTGTAGAAAGAGGTGTTGGTACAGGATGAACAGTGTATCCACCCTTATCGGCTGGTATTGCACATGCAGGAGCATCAGTTGACATAGGGATTTTTTCTTTACATATTGCAGGTGCTTCTTCTATTTTAGGAGCAGTAAACTTTATTACTACCGTAATTAACATACGATCTGCAGGAATAACAATAGACCGTATTCCATTATTTGTATGATCTGTATTTATTACAGCTATTTTACTTTTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thysanoessa raschii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thysanoessa raschii

Thysanoessa raschii, sometimes known as Arctic krill, is one of the most common euphausiid species of the subarctic and Arctic seas. They may reach 20–25 millimetres (0.8–1.0 in) long, and are sexually mature above 14 mm (0.6 in).[1]

T. raschii is a major prey item of several taxa, planktivorous fishes and marine mammals. It is also a common prey item of seabirds, including shearwaters.[2]

This species goes through a number of stages in its development. Roderick Macdonald defined the characteristics of fourteen stages, or 'furcilia'.[3]

References

  1. ^ M. J. de Kluijver & S. S. Ingalsuo. "Thysanoessa raschii". Macrobenthos of the North Sea. Universiteit van Amsterdam. Retrieved December 7, 2006. 
  2. ^ J. R. Lovvorn, C. L. Baduini, & G. L. Hunt (2001). "Modelling underwater visual and filter feeding by planktivorous shearwaters in unusual sea conditions". Ecology 82 (8): 2342–2356. doi:10.1890/0012-9658(2001)082[2342:MUVAFF]2.0.CO;2. ISSN 0012-9658. 
  3. ^ R. Macdonald (1928). "The life history of Thysanoessa raschii". Journal of the Marine Biological Association of the United Kingdom 15 (1): 57–80. doi:10.1017/S0025315400055533. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!