Overview

Distribution

depth in m: 50-1500; horizontal distribution: North and South Pacific; absent in the equatorial part; not found in the northern hemispere (south of 17°N); tropical and subtropical parts of the Indian and Atlantic Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Epipelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 201 specimens in 1 taxon.
Water temperature and chemistry ranges based on 198 samples.

Environmental ranges
  Depth range (m): 50 - 5357.5
  Temperature range (°C): 2.520 - 21.473
  Nitrate (umol/L): 0.235 - 42.002
  Salinity (PPS): 34.406 - 36.464
  Oxygen (ml/l): 1.874 - 5.846
  Phosphate (umol/l): 0.143 - 2.980
  Silicate (umol/l): 1.383 - 69.094

Graphical representation

Depth range (m): 50 - 5357.5

Temperature range (°C): 2.520 - 21.473

Nitrate (umol/L): 0.235 - 42.002

Salinity (PPS): 34.406 - 36.464

Oxygen (ml/l): 1.874 - 5.846

Phosphate (umol/l): 0.143 - 2.980

Silicate (umol/l): 1.383 - 69.094
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Accession numbers:
AY601097
AF296708
AF296701
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Census of Marine Zooplankton

Source: Census of Marine Zooplankton

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Thysanopoda obtusifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTTATTTTTGGTGCATGAGCTGGTATAGTAGGTACTTCACTAAGACTTATCATTCGAGCTGAATTAGGTCATCCAGGAAGATTAATTGGAGAT---GATCAAATCTATAATGTAGTAGTAACAGCTCATGCATTTGTCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATGGCATTCCCTCGGATAAACAATATAAGATTTTGATTACTACCCCCTTCATTAACATTATTATTAGGGAGAGGTTTAGTAGAAAGAGGAGTGGGAACAGGATGAACTGTATACCCTCCTTTATCAGCTAGAATTGCACATGCAGGAGCTTCAGTTGATATAGGAATTTTTTCTTTACATATTGCAGGAGCTTCTTCTATTTTAGGAGCTGTAAATTTCATTACAACTGTAATTAACATACGATCTTCAGGAATAACTATAGACCGAATTCCATTATTTGTATGGTCTGTATTTATTACAGCTATTTTACTTCTTTTATCACTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTCGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thysanopoda obtusifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!