Overview

Comprehensive Description

Biology: Nematocysts

More info
LocationImageCnidae TypeRange of
Lengths (m)
Range of
Widths (m)
nNState
Hand C. H., 1955
Actinopharynx
basitrichs  43 - 62  x  6 - 8  72 / Unfired
microbasic p-mastigophores  25 - 38  x  6 - 7.5  51 / Unfired
Column
basitrichs  9 - 12.5  x  2 - 3  53 / Unfired
basitrichs  15.5 - 24.5  x  2 - 3  67 / Unfired
Filaments
basitrichs  21.5 - 29  x  3 - 4  73 / Unfired
basitrichs  25 - 44  x  1.5 - 2  55 / Unfired
basitrichs  10 - 15.5  x  1.5 - 2  47 / Unfired
basitrichs  47 - 72  x  7.5 - 9  64 / Unfired
microbasic p-mastigophores  23 - 35  x  4.5 - 6  81 / Unfired
Tentacles
basitrichs  18.5 - 30  x  2 - 3.5  60 / Unfired
spirocysts  20 - 39.5  x  1.5 - 3  48 / Unfired
Song J. I. and Cha H. R., 2002
Actinopharynx
N/A basitrichs  31 - 35.5  x  2 - 3  /
N/A basitrichs  73 - 79  x  6 - 7  /
N/A microbasic p-mastigophores  23.5 - 28  x  6 - 7  /
Column
N/A basitrichs  10 - 14  x  2.5 - 3.5  /
N/A basitrichs  19 - 25  x  2.5 - 3.5  /
N/A microbasic p-mastigophores  25.5 - 26  x   - 7  /
N/A spirocysts  19 - 25.5  x  2.5 - 3  /
Filaments
N/A basitrichs  13 - 23  x  2.5 - 3.5  /
N/A basitrichs  66 - 69  x  6 - 7  /
N/A microbasic p-mastigophores  24 - 39  x  6 - 7  /
Tentacles
N/A basitrichs  11 - 14  x  2.5 - 3.5  /
N/A basitrichs  19.5 - 31  x  2.5 - 4  /
N/A spirocysts  21.5 - 41  x  2.2 - 4  /
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology/Natural History: This species usually is attached to a rock below the sediment with only the oral disk exposed, or subtidal individuals may be attached directly to a rock and not living in sediment. Predators include the leather star Dermasterias imbricata. This species may be a species complex.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As with all Urticina, this species has no acontia but does have tubercles on the column wall. The greenish oral disk has no radiating white stripes, and its margin has no sphaerules. The tentacles, which occur in 4 whorls, are stubby, blunt, and may have some faint but broad lighter colored cross-bands or may be green, pink, red, or blue. This species has a red column with red tubercles which accumulate sand and gravel and are usually not in rows. There is no green on the column. Its oral disk and tentacles are a mix of red and greenish-gray. It usually is partly buried in coarse sand or gravel. Up to 15 cm tall and 10 cm diameter.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Alaska to southern California; Europe (circumpolar)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Of anemones with a red column, Urticina lofotensis and U. columbiana have white tubercles arranged in rows. U. crassicornis may have a red column (usually with some green) but it does not accumulate sand and gravel and its tentacles usually have broad cross-bands. Urticina piscivora also has a red column but its inconspicuous tubercles do not accumulate sand and gravel. Cribrinopsis fernaldi has spherules at the margin of the oral disk and its tentacles have fine dark red zigzag bands across them. Most of the other red-columned anemones do not bury in sand or gravel.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 9.15
  Temperature range (°C): 9.967 - 10.345
  Nitrate (umol/L): 5.774 - 7.050
  Salinity (PPS): 31.893 - 32.083
  Oxygen (ml/l): 6.535 - 6.561
  Phosphate (umol/l): 0.883 - 0.968
  Silicate (umol/l): 12.975 - 15.658

Graphical representation

Depth range (m): 0 - 9.15

Temperature range (°C): 9.967 - 10.345

Nitrate (umol/L): 5.774 - 7.050

Salinity (PPS): 31.893 - 32.083

Oxygen (ml/l): 6.535 - 6.561

Phosphate (umol/l): 0.883 - 0.968

Silicate (umol/l): 12.975 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 2 taxa.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 30
  Temperature range (°C): 6.524 - 11.938
  Nitrate (umol/L): 4.644 - 10.097
  Salinity (PPS): 32.854 - 35.254
  Oxygen (ml/l): 6.104 - 7.403
  Phosphate (umol/l): 0.333 - 1.161
  Silicate (umol/l): 2.348 - 22.113

Graphical representation

Depth range (m): 0 - 30

Temperature range (°C): 6.524 - 11.938

Nitrate (umol/L): 4.644 - 10.097

Salinity (PPS): 32.854 - 35.254

Oxygen (ml/l): 6.104 - 7.403

Phosphate (umol/l): 0.333 - 1.161

Silicate (umol/l): 2.348 - 22.113
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal to 45 m

Habitat: Buried in coarse sand or gravel in tidepools, subtidal, may be on rock walls subtidally.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Tealia coriacea preys on:
zooplankton
Strongylocentrotus purpuratus

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
  • R. J. Rosenthal, W. D. Clarke, P. K. Dayton, Ecology and natural history of a stand of giant kelp, Macrocystis pyrifera, off Del Mar, California. Fish. Bull. (Dublin) 72(3):670-684, from p. 683 (1974).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Tealia coriacea is prey of:
Dermasterias imbricata

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
  • R. J. Rosenthal, W. D. Clarke, P. K. Dayton, Ecology and natural history of a stand of giant kelp, Macrocystis pyrifera, off Del Mar, California. Fish. Bull. (Dublin) 72(3):670-684, from p. 683 (1974).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urticina coriacea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAT---GATCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTCTTCCTAGTAATGCCAGTAATGATAGGAGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAACAATATTAGTTTTTGGCTACTTCCTCCCGCGCTTATACTATTACTAGGTTCTGCCTTTGTTGAGCAAGGAGTGGGAACAGGGTGGACGGTATACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCACCGGGATTAACGATGGATAGACTCCCGCTATTTGTGTGGTCCATTTTAATTACTGCCTTTTTATTATTACTCTCCCTACCAGTCTTAGCAGGTGGRATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGATCCCATCTTATTCCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Urticina coriacea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!