Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 2712
Specimens with Sequences: 1992
Specimens with Barcodes: 1912
Species: 143
Species With Barcodes: 122
Public Records: 983
Public Species: 93
Public BINs: 111
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis aff. Nigricans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. alcathoe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. ater

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis riparius PS1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTAATATTTGGTGCCTGAGCGGGGATAGTAGGCACTGCATTGAGCTTACTAATCCGCGCCGAATTAGGCCAACCAGGAGCCCTGTTAGGGGATGATCAAATTTATAACGTAATTGTTACTGCTCACGCTTTTGTAATGATTTTCTTTATAGTTATGCCTATTATAATTGGAGGTTTCGGAAACTGATTAGTACCCCTAATAATTGGTGCCCCTGATATGGCTTTCCCTCGAATAAACAACATAAGCTTTTGACTACTTCCTCCCTCCTTCCTATTACTGCTTGCCTCATCTATAGTTGAAGCAGGAGCAGGTACCGGTTGAACAGTATACCCCCCTCTAGCAGGGAATCTTGCTCATGCAGGGGCTTCAGTTGATCTTGCCATCTTCTCCTTACACCTGGCAGGTGTGTCCTCAATTTTAGGGGCAATTAATTTTATTACCACTATTATTAATATAAAACCTCCCGCACTTTCTCAATATCAAACACCATTGTTTGTTTGATCTGTCCTAATTACAGCTGTGCTGCTTCTTCTATCGCTTCCAGTCCTAGCTGCTGGAATTACAATATTACTAACAGATCGTAATCTTAATACTACTTTTTTTGATCCTGCCGGAGGAGGAGACCCAATCTTATACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis riparius PS1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis riparius PS2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTAATATTTGGTGCCTGAGCGGGGATAGTAGGAACTGCATTAAGCTTACTAATCCGCGCCGAACTAGGTCAACCAGGAGCCCTGTTAGGGGATGACCAAATTTATAACGTAATTGTTACTGCTCACGCCTTTGTAATGATTTTCTTTATAGTTATGCCTATTATAATTGGAGGTTTCGGAAACTGATTAGTACCCCTAATAATTGGCGCTCCCGATATGGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTACTCCCTCCCTCTTTCCTATTACTGCTTGCTTCATCTATAGTTGAAGCAGGAGCAGGTACCGGTTGAACAGTATACCCCCCTCTAGCAGGAAATCTTGCTCACGCAGGAGCTTCAGTTGACCTTGCCATCTTCTCCTTACACCTGGCAGGTGTGTCCTCAATTTTAGGGGCAATTAACTTTATTACGACTATTATTAATATAAAACCTCCCGCACTTTCTCAATATCAAACACCATTATTTGTTTGATCTGTCCTAATTACAGCTGTACTGCTTCTTCTATCGCTCCCAGTCCTAGCTGCTGGAATTACAATGTTACTAACAGACCGTAATCTTAATACCACTTTTTTTGATCCTGCCGGAGGAGGAGACCCAATCTTATACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis riparius PS2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis riparius PS3

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTTATATTTGGTGCCTGAGCTGGAATAGTAGGTACTGCACTCAGCTTACTAATCCGCGCCGAACTAGGTCAACCAGGAGCTCTATTAGGGGATGACCAAATTTATAATGTAATTGTTACGGCTCATGCCTTCGTGATAATTTTCTTCATAGTTATGCCTATCATAATTGGAGGATTCGGAAACTGACTAGTACCCTTAATAATCGGTGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGCTTTTGACTGCTTCCTCCATCTTTCCTACTACTACTTGCTTCATCTATAGTTGAAGCAGGAGCAGGCACTGGTTGAACAGTATATCCCCCTCTAGCAGGAAATCTTGCTCACGCAGGAGCCTCAGTCGACCTCGCTATCTTTTCCCTACACTTAGCAGGTGTATCCTCAATTTTAGGGGCAATCAACTTTATTACCACCATTATTAATATAAAACCCCCTGCACTCTCTCAATACCAGACACCATTATTTGTTTGATCCGTTCTTATTACAGCTGTTCTACTTCTCCTCTCTCTCCCAGTACTAGCCGCKGGAATTACAATATTATTAACTGATCGAAACCTTAATACCACTTTTTTTGATCCTGCTGGAGGGGGAGACCCTATCTTGTATCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis riparius PS3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis CMF sp. E

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTACCTACTGTTTGGTGCTTGAGCTGGAATAGCAGGCACTGCTCTAAGCTTACTAATTCGCGCAGAACTGGGTCAACCAGGAGCTTTATTAGGAGATGACCAAATTTATAATGTAATTGTTACTGCTCATGCTTTCGTAATAATCTTTTTTATAGTAATGCCTATTATAATTGGAGGGTTTGGAAATTGATTAGTACCATTAATAATCGGAGCTCCCGATATAGCTTTCCCTCGTATAAATAACATGAGTTTTTGACTTCTTCCCCCTTCCTTTTTACTATTATTAGCCTCATCTATAGTTGAAGCGGGGGCAGGAACTGGCTGAACAGTTTACCCTCCCTTAGCAGGAAATCTAGCTCATGCAGGAGCTTCTGTTGATCTAGCTATTTTTTCTCTACACTTAGCAGGTGTCTCTTCAATTTTAGGAGCAATTAATTTTATTACTACCATTATTAATATAAAACCCCCTGCACTATCTCAATATCAAACACCACTGTTTGTTTGATCTGTATTAATCACAGCTGTACTACTCCTTCTCTCTCTCCCAGTTCTAGCTGCTGGAATTACAATACTACTAACAGATCGAAATCTTAACACTACTTTTTTTGATCCTGCTGGGGGAGGAGACCCAATTCTGTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis CMF sp. E

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis cf. laniger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTGTACCTATTATTTGGTGCTTGAGCTGGTATAGCAGGCACTGCCCTAAGTTTACTTATTCGCGCAGAATTAGGCCAACCAGGGGCCTTATTAGGAGACGATCAGATCTATAATGTAATCGTTACTGCCCATGCTTTTGTAATAATTTTCTTCATAGTCATACCTATTATAATCGGAGGCTTCGGAAATTGACTAGTGCCTTTAATAATTGGAGCCCCCGATATAGCTTTCCCTCGAATGAATAATATGAGTTTCTGACTTCTTCCTCCCTCTTTTTTATTACTGCTAGCTTCATCCATGGTTGAAGCAGGAGCCGGTACCGGTTGAACAGTCTATCCACCCTTAGCAGGAAATCTTGCCCACGCAGGAGCTTCTGTTGATCTTGCTATCTTTTCTCTGCATCTGGCAGGTGTATCTTCAATCTTGGGGGCCATTAACTTTATTACTACCATTATTAATATAAAACCACCTGCTCTCTCTCAATATCAAACACCACTGTTTGTCTGATCTGTCCTAATTACAGCTGTATTACTTCTTCTTTCTCTTCCCGTTTTAGCTGCTGGAATTACAATACTATTAACAGATCGAAATTTAAATACTACCTTTTTTGACCCTGCTGGGGGAGGAGATCCAATTCTGTATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. laniger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. bocagii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis nigricans PS2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis nigricans PS1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTAATATTTGGTGCTTGAGCTGGAATAGTAGGCACTGCATTAAGCCTACTGATTCGCGCCGAACTGGGTCAACCAGGAGCTCTACTAGGGGATGATCAGATCTATAATGTAGTTGTTACTGCCCACGCTTTTGTAATAATTTTCTTTATAGTCATGCCTATTATAATCGGAGGCTTTGGAAACTGACTAGTACCATTGATAATTGGTGCGCCTGACATGGCTTTCCCTCGAATAAATAACATAAGCTTTTGACTACTTCCCCCCTCCTTTCTGCTACTGCTTGCCTCATCTATAATTGAAGCAGGGGCAGGTACTGGTTGAACAGTATACCCCCCTCTAGCAGGAAATCTAGCCCACGCAGGAGCCTCCGTTGATCTTGCTATCTTTTCCTTACACTTGGCAGGTGTCTCTTCGATCTTAGGGGCAATTAACTTTATTACTACTATTATCAATATAAAACCTCCCGCACTTTCTCAATACCAAACACCATTGTTTGTTTGATCAGTTTTAATTACAGCTGTTCTACTTCTCCTATCGCTCCCAGTTCTAGCTGCCGGAATTACAATACTATTAACAGACCGTAATCTTAATACTACTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATCTTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis nigricans PS1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis cf. alcathoe

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTGTACTTACTATTTGGCGCTTGAGCCGGTATGGTAGGAACCGCACTAAGTCTATTAATTCGTGCAGAACTAGGCCAACCAGGAGCCTTACTAGGAGATGATCAGATTTATAATGTAATTGTTACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTAGTACCTTTAATAATTGGGGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCTCCGTCTTTCCTATTATTATTAGCCTCATCAATAGTAGAGGCAGGAGCGGGAACTGGTTGAACAGTTTATCCCCCTTTAGCAGGAAATCTTGCTCATGCAGGAGCTTCCGTTGACCTTGCTATCTTCTCTCTACACTTAGCAGGTGTATCTTCAATCTTAGGGGCAATTAACTTTATTACTACTATCATTAACATAAAACCTCCCGCACTTTCCCAGTATCAAACACCACTGTTTGTCTGATCTGTCTTAATTACCGCTGTACTCCTTCTACTATCCCTTCCAGTCCTAGCCGCCGGAATCACAATACTACTAACAGATCGAAACCTAAATACTACTTTCTTCGATCCTGCTGGAGGAGGAGATCCAATTCTGTATCAACATCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis cf. muricola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 42 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTGTACCTATTATTTGGTGCCTGAGCTGGTATGGCAGGCACTGCTCTAAGTCTATTAATTCGTGCAGAACTAGGTCAGCCAGGGGCCTTGCTAGGAGATGATCAAATTTATAATGTAATCGTCACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTAATGCCTATTATAATTGGAGGCTTTGGAAATTGACTAGTACCATTAATAATTGGGGCTCCTGACATAGCTTTTCCCCGAATAAACAATATAAGCTTCTGACTTCTCCCTCCCTCATTTCTACTGCTATTAGCCTCATCTATAGTTGAAGCAGGGGTGGGTACTGGTTGAACAGTATACCCTCCTTTAGCAGGAAATCTCGCTCACGCAGGAGCCTCTGTTGATCTCGCTATCTTCTCTCTACACCTGGCAGGTGTGTCTTCAATCTTAGGAGCTATTAATTTTATTACTACTATTATTAATATAAAACCACCTGCACTCTCCCAATATCAGACACCATTGTTTGTTTGATCCGTACTAATCACAGCTGTACTACTTCTTCTTTCCCTCCCAGTTCTAGCTGCCGGAATTACAATGTTACTAACAGATCGAAACTTAAATACTACTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. muricola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis cf. aurascens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTACCTACTATTTGGTGCTTGAGCCGGTATAGCAGGCACAGCACTGAGCTTACTAATTCGCGCAGAATTAGGTCAGCCAGGGGCTCTGTTAGGAGATGATCAAATTTATAATGTAATTGTCACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTAATGCCTATCATAATCGGAGGCTTTGGGAATTGACTAGTACCCCTAATGATTGGTGCTCCTGATATGGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTACTTCCTCCATCTTTTTTATTACTATTAGCCTCATCTATAGTTGAAGCAGGGGCAGGCACTGGTTGAACAGTCTACCCCCCTCTAGCAGGGAATCTTGCTCACGCAGGAGCTTCTGTTGATCTTGCTATCTTTTCCCTACATTTAGCAGGTGTATCTTCAATTCTGGGAGCAATTAACTTTATTACTACTATTATTAATATAAAACCTCCTGCACTTTCTCAATATCAGACACCATTATTTGTTTGATCTGTTTTAATTACAGCTGTACTACTTCTTCTTTCTCTTCCAGTTCTGGCTGCAGGAATTACAATATTATTAACAGACCGAAATTTAAATACTACTTTTTTCGATCCTGCTGGAGGAGGGGATCCAATCCTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. aurascens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mouse-eared bat

For the species sometimes known as the mouse-eared bat, see Greater mouse-eared bat.
Skeleton of Myotis lucifugus found in Wooster, Ohio, USA.
Skeleton (frontal view) of Myotis lucifugus found in Wooster, Ohio, USA.

The mouse-eared bats (Myotis) are a diverse and widespread genus of bats within the family Vespertilionidae.

Relationships[edit]

Myotis has historically been included in the subfamily Vespertilioninae, but was classified in its own subfamily, Myotinae, by Nancy Simmons in 1998. In her 2005 classification in Mammal Species of the World, Simmons listed the genera Cistugo and Lasionycteris in Myotinae in addition to Myotis itself.[1] However, molecular data indicate that Cistugo is distantly related to all other Vespertilionidae, so that it was reclassified into its own family Cistugidae,[2] and that Lasionycteris belongs in Vespertilioninae.[3] Thus, Myotis is the only remaining genus within Myotinae.[3]

Characteristics[edit]

Ears are normally longer than they are wide, with a long and lance-shaped tragus, and thence the English and zoological names (in Greek, myotis and myosotis mean "mouse-ear"). The species within this genus vary in size from very large to very small, with a single pair of mammary glands.

Species[edit]

Myotis

Myotis latirostris




Most Old World species




Most Nearctic species




Myotis brandtii



Neotropical and some Nearctic species






Relationships among Myotis species according to molecular data[4]

Traditionally, Myotis has been divided into three large subgenera—Leuconoe, Myotis, and Selysius. However, molecular data indicate that these subgenera are not natural groups, but instead unnatural assemblages of convergently similar species.[5] Instead, Myotis species largely fall in two main clades, one containing Old World and the other New World species.[4] However, the Asian species Myotis latirostris falls outside the clade formed by these main groups, and may represent a separate genus,[6] and the Eurasian Myotis brandtii is related to New World species.[7]

Myotis is a highly species-rich genus, and the classification of many species remains unsettled. In the below list, all differences in taxonomy from the 2005 third edition of Mammal Species of the World,[8] are indicated in footnotes.

See also[edit]

Notes[edit]

  1. ^ Split from M. mystacinus (Mayer et al., 2007).
  2. ^ A new species (Happold, 2005).
  3. ^ Split from M. nattereri (Ibáñez et al., 2006).
  4. ^ Split from M. formosus (Jiang et al., 2010).
  5. ^ Split from M. brandtii (Ohdachi et al., The Wild Mammals of Japan, 2009).
  6. ^ Split from M. muricola (Stadelmann et al., 2007).
  7. ^ Split from M. daubentonii (Matveev et al., 2005). Includes M. abei (Tsytsulina, 2004, as daubentonii).
  8. ^ A new species (Borisenko et al., 2008).
  9. ^ Split from M. adversus (Han et al., 2010).

References[edit]

  1. ^ Simmons, 2005, p. 499
  2. ^ Lack et al., 2010
  3. ^ a b Roehrs et al., 2010
  4. ^ a b Stadelmann et al., 2007, fig. 2; Lack et al., 2010, figs. 1, 2
  5. ^ Simmons, 2005, p. 500
  6. ^ Lack et al., 2010, p. 984
  7. ^ Stadelmann et al., 2007, fig. 2
  8. ^ Simmons, 2005, pp. 500–518

Literature cited[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!