Overview

Comprehensive Description

Biology: Nematocysts

More info
LocationImageCnidae TypeRange of
Lengths (m)
Range of
Widths (m)
nNState
Carlgren O., 1945
Actinopharynx
N/A basitrichs  35.2 - 46.5  x (2.5)  3 -   /
Column
N/A basitrichs  18.3 - 23.3  x  2.8 - 3  /
Filaments
N/A basitrichs  13.4 - 16.9  x   - 2  /
N/A microbasic p-mastigophores  26.8 - 28.2  x  5.6 - 6.3  /
N/A microbasic p-mastigophores  28.2 - 29.6  x  4.9 - 5.6  /
Tentacles
N/A basitrichs  36.7 - 45.1  x  3 - 3.5  /
N/A spirocysts   - 44  x   - 4.2  /
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 48 - 48
  Temperature range (°C): -0.519 - -0.519
  Nitrate (umol/L): 2.857 - 2.857
  Salinity (PPS): 34.490 - 34.490
  Oxygen (ml/l): 7.996 - 7.996
  Phosphate (umol/l): 0.468 - 0.468
  Silicate (umol/l): 2.651 - 2.651
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 200 - 504
  Temperature range (°C): -1.086 - -1.086
  Nitrate (umol/L): 25.670 - 25.670
  Salinity (PPS): 34.459 - 34.459
  Oxygen (ml/l): 7.327 - 7.327
  Phosphate (umol/l): 2.171 - 2.171
  Silicate (umol/l): 68.056 - 68.056

Graphical representation

Depth range (m): 200 - 504
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urticinopsis antarctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATTTAGTGTTTGGAATAGGGTCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAC---GACCATCTTTATAATGTCATAGTGACGGCACATGCCTTTATTATGATTTTTTTCCTAGTAATGCCAGTAATGATAGGGGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAATAATATTAGTTTTTGGTTACTTCCTCCCGCGCTTATACTATTACTAGGCTCTGCTTTTGTTGAGCAAGGAGTAGGGACAGGGTGGACGGTTTACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCCCCGGGATTAACGATGGATAGACTTCCGCTATTTGTGTGGTCTATTTTAATTACTGCCTTTTTATTATTACTTTCCCTACCAGTCTTAGCGGGTGGAATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGGGGTGGAGATCCCATTTTATTCCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Urticinopsis antarctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!