Overview

Comprehensive Description

The Beautiful Demoiselle (Calopteryx virgo) is a large, dark damselfly, with a very wide geographic distribution across Europe. It is typically found along small, clean, rapidly flowing forest streams, sometimes in large numbers, where it flutters about with a butterfly-like flight, settling frequently on trees and bushes along the stream border. (Askew 2004; Dijkstra and Lewington 2006)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Calopteryx virgo is found from western Europe east to Japan (although it is possible the Japanese form represents a distinct species) (Misof et al. 2000).

Askew (2004) gives the distribution of C. virgo as extending from the west of Scotland, Ireland, and Scandinavia south to North Africa, with the species (or superspecies) extending across Asia to Japan. Askew notes that the Japanese subspecies might better be recognized as a distinct species, C. japonica (Askew 2004 and references therein).

Dijkstra and Lewington (2006) state that C. virgo is locally common east to the Urals, but is absent from large areas in the south, such as on many islands, and in Anatolia it is mainly limited to coastal areas, rare on the plateau.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Several forms of Calopteryx virgo are distinguished by wing color and are usually treated as subspecies, but in general this is the largest and darkest Calopteryx in Europe (Dijkstra and Lewington 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Calopteryx virgo prefers cooler running waters than other European Calopteryx, these streams being typically smaller, more shaded, or at higher latitudes. It is clasically found around small forest streams. Where streams broaden or open up, it may be replaced by C. splendens (with which it sometimes hybridizes). (Dijkstra and Lewington 2006) Calopteryx virgo flies slowly and settles frequently on trees and bushes bordering streams and rivers with clean, rather rapidly flowing water (Askew 2004).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In a study in western Norway, Calopteryx virgo were found to be infected by the eugregarine protozoan parasite Hoplorhynchus oligacanthus, with females more heavily infected than males (Abro 1996)

Svensson and Friberg (2007) studied the relative effects of predation by birds (wagtails, Motacilla spp.) on wing morphology of Calopteryx virga and C. splendens in sympatry in Sweden. Predation risk was almost three times higher for C. virgo (which has a much greater degree of wing melanization) than it was for the less extensively melanized C. splendens. The almost entirely black wings of C. virgo presumably make males of this species conspicuous to visual predators such as birds, thereby increasing male mortality rate. Wagtails appear to be driving natural selection favoring smaller wingpatch size in male C. virgo, i.e., a phenotype that is more similar to C. splendens. In addition to possibly influencing the evolution of wingpatch size in C. virgo, wagtail predation may directly benefit C. splendens. Because C. virgo is competitively superior to C. splendens in interspecific territorial interactions (Tynkkynen et al. 2005), selective predation on C. virgo by wagtails may have an indirect positive effect on C. splendens. (Svensson and Friberg 2007)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Dijkstra and Lewington (2006) report the flight season for C. virgo as May to late September.

Askew (2004) writes that in northern Europe C. virgo flies mainly from June and July until early August, but that in southern Europe it appears in May (or even late April) and may be seen until early September.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Koskimaki et al. (2004) carried out experiments with Calopteryx virgo to test the common hypothesis in behavioral ecology that the ability to defend a resource provides an indication of a potential mate's quality. Calopteryx virgo males defend territories containing one or more oviposition sites (emergent aquatic vegetation) where pair formation and guarded oviposition (egg-laying) occur. Territory ownership is settled by aerial contests that can be intense and prolonged between closely matched contestants.

Koskimaki et al. found that in staged contests between males, winners of the contests showed higher immunocompetence (measured as encapsulation in response to insertion of a 1.7 to 1.8 mm piece of nylon monofilament) and greater fat reserves. They also examined 29 males that had not been used in staged contests, and confirmed that in these males, also, encapsulation response correlated positively with an individual’s fat reserves. Thus, both immunocompetence and resource holding potential seem to depend on energy reserves, suggesting a trade-off between parasite resistance and energetically costly territorial behavior. (Koskimaki et al. 2004)

Tynkkynen et al. (2004) studied the evolutionary effects of geographic overlap between Calopteryx virgo and C. splendens in Finland, reporting three key findings. First, C. splendens males, which have pigmented iridescent blue wing patches which exhibit a high degree of both local and geographic variation (Tynkkynen et al. 2004 and references therein), were found to have smaller dark pigmented wing patches in populations with a high relative frequency of C. virgo (which have almost entirely pigmented wings and resemble C. splendens males with the largest wing patches) than in populations where C. virgo was relatively rare. Second, C. virgo males responded more aggressively to C. splendens with large wing patches than to those with small wing patches. Third, in all interspecific territory disputes, C. virgo won. Based on these results, Tynkkynen et al. suggest that interspecific aggression may have caused character displacement (a reduction in C. splendens wing patch size where it occurs with C. virgo) to reduce attacks by C. virgo males. This hypothesis is supported by experiments in which C. virgo were removed from some populations (Tynkkynen et al. 2005). Evidence suggests that mistaken species recognition may account for the interspecific territorial behavior observed in these two species (Tynkkynen et al. 2004, 2006).

The flight of C. virgo is butterfly-like, though heavier than that of C. splendens (Dijkstra and Lewington 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Like other Odonata (dragonflies and damselflies), Calopteryx virgo has an unusual mode of reproduction involving indirect insemination and (like many insects and other animals) delayed fertilization. Sperm is transferred by the male from the tip of his abdomen (where it is produced) to secondary genitalia at the base of his abdomen, from which it is passed to the female during an acrobatic copulation in which the mating pair forms a "copulation wheel". Eggs are not fertilized until just before they are laid. (Dijkstra and Lewington 2006)

Wellenreuther et al. (2010) investigated possible impacts of climate change on hybridization rates between Calopteryx virgo and C. splendens. In some regions these two species are sympatric (i.e., they are both present), whereas in other regions only one or the other is present (i.e., they are allopatric). It is expected that as the climate warms, C. splendens will extend its range northward, eventually overlapping with C. virgo in northern Scandinavia. Wellenreuther et al. studied courtship responses of male C. virgo toward female C. splendens from sympatric populations with various proportions of C. virgo, as well as from allopatric populations. Male courtship responses of C. virgo toward conspecific females showed moderate geographic variation, but courtship attempts toward heterospecific C. splendens females increased significantly from sympatry to allopatry. The authors suggest that allopatric C. virgo males have partly lost their ability to discriminate against heterospecific females. Given this apparently reduced premating isolation in allopatry relative to sympatry, as ranges shift in response to climate change, bringing once allopatric populations into sympatry, an increase in hybridization (heterospecific mating) may result. (Wellenreuther et al. 2010)

Work by Tynkkynen et al. (2008) suggests that the majority of copulations between C. virgo and C. splendens (which appears to be regular, if not common, events) may be forced by males, or possibly be the result of female avoidance of harassment arising from persistent courtship displays of heterospecific males.

Cordoba-Aguilar (2002) and Rivera et al. (2004) discuss the ability of C. virgo males to displace the sperm of rival males from a female's sperm storage organs, including the limitations of this ability (males can remove rival sperm from the bursa copulatrix, the temporary sperm storage organ in the female, but sperm become inaccessible to the male once they have moved into the spermatheca).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calopteryx virgo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATTACAACAACAATTAACATAAAAACTCCAGGAATAAAGATAGACCAAATACCTTTATTAGTGTGAGCCGTAGTAATCACTGCGGTCCTTCTATTATTATCTCTCCCAGTACTTGCTGGG---GCCATTACAATACTACTAACTGACCGTAATATAAATACATCATTCTTTGACCCTGCGGGAGGAGGAGATCCAATTTTATACCAGCATTTATTTTGATTCTTTGGACATCCAGAAGTATATATTCTAATTCTACCAGGGTTTGGTATGATCTCTCACATTATTGCACAAGAGAGAGGAAAAAAG---GAAACATTTGGAGTATTAGGTATAATCTACGCAATACTAGCAATTGGATTATTAGGATTTGTAGTATGAGCTCACCATATATTTACAGTAGGAATAGATGTAGATACACGGGCATATTTTACATCTGCCACAATAGTAATCGCTGTTCCAACGGGAATTAAGATTTTCAGATGATTA---GCTACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calopteryx virgo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Beautiful Demoiselle

The Beautiful Demoiselle (Calopteryx virgo) is a European damselfly. It is often found among fast-flowing waters.

Contents

Description

Eggs and larvae

Females lay up to 300 eggs at a time on emergent or floating plants, often on water-crowfoot. Like the Banded Demoiselle, they often submerge to do so. The eggs hatch after around 14 days. Again, like the Banded Demoiselle, the larva is stick-like with long legs and develops over a period of two years in submerged vegetation, plant debris or roots. They usually overwinter in mud or slime.

The larvae of the Beautiful Demoiselle develop over 10 to 12 stages, each of which takes place between a molt. The body length is variable and highly dependent on environmental conditions. The final stage (F-0-stage) larvae are 3.5 to 4.6 millimeters and weigh about 4 milligrams, slightly below the Banded Demoiselle. Apart from the larvae of the Demoiselles are difficult to distinguish from each other, the apparent differences lie mainly in the bristles and the severity of the tracheal gills on their abdomen. Compared to other damselflies Demoiselles larvae fall immediately on the other hand, due to their much shorter mean gill lamella.

The body of the larvae shows only a relatively small adjustment to the fast-flowing waters of their habitat. The body is not flattened but very slim and turning around, the legs are long and have its end with strong claws, with which it can be stated in the vegetation. Because they reside within the water body, but mainly in the quieter areas, the danger of being swept with the flow, is relatively low. If this happens, they clearly its long body and legs stretched as far as possible to get in touch with the vegetation or the substrate to come.

Adult

The male usually has much more extensive pigmentation on the wings than other Calopteryx species in its range: in the south east of its range (the Balkans and Turkey) the wings are entirely metallic blue while in other areas, there are clear areas at the base and tip of the wing. Immature insects often have much paler, browner wings. They have metallic blue-green bodies and blue-green eyes.

The female has dark brown iridescent wings, a white patch near the tip of the wings (called a pseudopterostigma) and a metallic green body with a bronze tip of the abdomen.

Distribution

The distribution of the Beautiful Demoiselle covers all of Europe with the exception of the southwestern Iberian Peninsula, the Balearic Islands and Iceland. In the north it extends to the Arctic polar sea, and thus much further north than that of the banded demoiselle. On the North African Mediterranean coast, its southern populations in Morocco and Algeria can be found.[1] The northern boundary in Asia following the 13-°C July isotherm , it is therefore not in the areas where the average temperature in summer below 13°C falls, otherwise they are met with in temperate and cool regions in the entire continent with the exception of deserts and the mountains of. The eastern subspecies of C. v. japonica found on the Japanese islands is under debate as to whether it is a separate species. The Beautiful Demoiselle is mostly found in lowland locations. Regular findings come from areas up to a maximum height of 980 m above sea level. Occasionally they may be found up to 1,200 meters in altitude, such as in the Alps.

Habitat

Biotope

Male Beautiful Demoiselle

The blue-wing Demoiselle lives mainly on small to medium sized streams and other watercourses. These are characterized by a relatively low water temperature and a moderate to fast flow. The water must not be nutrient rich (eutrophic). In the northern part of their range, such as in Norway and Finland, it is also found in medium-sized rivers or even larger streams. The waters are usually in the immediate vicinity of forests.

Larval habitat

The larvae live in the aforementioned streams and are mainly due to the vegetation found in the water. The larvae need the stems and leaves, especially in areas with stronger currents in order to hold on. It is on the other hand, it is extremely rare to find them on barren locations, flat expiring banks, or areas with a smooth stone floor. They live in quieter areas between alluvial leaves or on exposed roots of the vegetation. They can be found on submerged plants such as waterweed (Elodea sp.), floods for water crowfoot (Ranunculus fluitans) or other plants. They adhere to a rule in the depths of a few centimeters to several decimeters. Compared with the larvae of the banded demoiselle prefer the larvae of the blue-wing Demoiselle rather quieter areas of the water, since lower flow more effective absorption of oxygen is made possible from the water. Only in very rare cases, however, we find the larvae in stagnant water. The substrate of the river has only a very minor importance, because the larvae reside mainly in the vegetation. An important factor for the occurrence of blue-wing Demoiselles is the oxygen of the water supply. The larvae react with oxygen deficiency is much more sensitive than the larvae of the banded demoiselle, so that the oxygen saturation of the water must be correspondingly high. Waters with high levels of sediment and sludge , which is consumed by bacterial decomposition of oxygen are, accordingly not as a habitat for the larvae. Because of this sensitivity, the other factors of the water chemistry is concerned, the animals as a bioindicator for the assessment of water quality are used. Thus they will be in accordance with DIN an indication of value in the saprobic assigned of 1.9, which represents a low to moderately polluted waters type (β-mesosaprob) and a water quality class from I to II does. Another key factor for the occurrence of the larvae of the blue-wing Demoiselle is the heat balance of the water. This species prefers different from the banded demoiselle, especially the cooler and shadier areas of the water. This is indicated as optimal temperature a summer average 13 to 18 °C. At temperatures above 22 °C were often injuries of larvae and observed mainly a reduced hatchability of eggs. The main reason is not, however, the temperature, but the associated reduced capacity of the water for oxygen and the consequent lower oxygen content. Individual populations may, however, used to permanently higher temperatures.

Adult habitat

The habitat of the adults occupy corresponds to nearby larval habitat. Unlike the adults of the banded demoiselle you meet those of the Deautiful Demoiselle but also in forest clearings, but very rarely on the banks of larger pond. As resting places, the animals need trees and shrubs, but often enough and high herbaceous plants such as stocks of large nettle ( Urtica dioica ) from. The breeding habitats meet the future Larvalhabitaten, these are for cool, shady water-courses largely with a more or less strong current and near-natural vegetation and bank structure. This is mostly meadow and pasture streams in the area, they rarely pass through the forest. A distinct riparian vegetation plays obviously also play a role as a windbreak, because the animals may be due to their broad wings blown away by the wind more easily than other species of dragonflies.

Behaviour

Males are territorial, perching in bankside plants and trees. They chase passing insects, often returning to the same perch. Males can stray well away from water, females live away from water unless egg-laying or seeking a mate.

As with the banded demoiselle is also in the blue wing-demoiselle a pronounced territorial behavior of sexually mature males. These days occupy territories that they defend against other males. The defense consists mostly in threatening gestures. For this they spread their wings and put them on display so clearly visible, there is also Drohflügen and in rare cases to air combat between rival males. Optimal areas correspond to the optimal nesting places for the females and are characterized by a normally increased flow and a suitable oviposition substrate in the potential breeding sites from. The size of the spots and their distance apart is the density of the population dependent as well as the occurrences of the water and may be between several meters and a few decimetres. Males who do not occupy spots can keep themselves in the vegetation on the shore and try to mate with fly to females or to fill vacant spots. Especially when only a few males are present, the territorial defense is very aggressive, with a higher number of competing male aggression but decreases significantly. The males sit in their areas mostly in exposed places in the vegetation, which extends over the water, sometimes on vegetation or rocks cushions amid the waters. This seat is waiting at the same time the center of the district they do their gaze primarily on the aquatic center and will show a behavior that is referred to as "wingclapping" and in which the wings beat quickly down and slowly lifted. It is believed that it is mainly used for communication, it also supports the ventilation in the thorax and accordingly probably also plays a role in thermoregulation of the animals

Flight

Male prior to flight

The first adults of dragonflies emerge, depending on the weather, at the end of April to the end of September. The Hauptschlüpfzeit lies in the days of late May to late June. The emergence , ie the transformation of the larvae to adults and the associated leaving the water, is not synchronous and lasts throughout the season until about mid-July. The newly hatched dragonflies spend after leaving the larval shell ( exuvia ) is the first time until full coloration in the vegetation surrounding the water body. This aging period usually lasts about 10 days, after which they return to the waters. The adult animals live only one season, it was a lifetime determined from about 40 to 50 days. Throughout the day there are males in sunlit waters are already in the early morning (in Central Europe between 7.00 und 9.00 clock clock), where they stay forever in the areas that are exposed directly. In the aquatic environment, shaded according to the animals appear later, usually basking in the tops of the surrounding vegetation. Females fly over during the day, the waters in search of suitable nesting sites, the main activity of both sexes such as hunting, advertising , mating and egg laying occurs in the warm midday hours. At night the animals as well as sit in the early morning sun-drenched coves in the vegetation at these sites, they also spend the night. The radius of action and thus the distance between breeding, hunting and rest area is in the males of 20–100 meters and is therefore very small, the females were observed, however walking distances of up to four miles per day.

Mating and egg laying

Mating
Females during oviposition

Mating takes place in a way that for the genus Calopteryx and is typical of an eye-catching advertising behavior precedes. The females fly over the water, always in search of suitable nesting places and fly it through the territories of males. The males who recognize the females to the reflections of the moving wings, fly towards it, once they have crossed the border area. They use a striking Schwirrflug that only in the courtship will be shown, and demonstrate the underside of its abdomen raised high. The last three segments of it are much brighter and are referred to as a "lantern" that will be presented. The male leads in this way, the female to the nesting sites ("Show flight") and circled it on the water once it has settled out. Then in turn followed by a period of Schwirrflugs and only if the female is sitting there and so his willingness to mate signaled it comes to mating. In return, the male is on the wings of the female and begins copulation , which can last between 40 seconds and 5 minutes, the animals themselves as Paarungsrad can rely on the vegetation. After mating, the male releases the female again and again shows this is the nesting place, the female abdomen with drooping sit for a few seconds ("post-copulatory rest") and then follows the male. The eggs are laid in the stems of aquatic plants in the water level and below, where the female can submerge up to 90 minutes. It climbs here (unlike almost all other species of dragonflies) upside down on the stem down and stabs the eggs with the egg-laying apparatus ( ovipositor ) almost vertically into the stems. During the nesting above the water surface while the female is the male defended against other males. Both sexes mate several times a day for several weeks until her death.

Larval development and life of larvae

he eggs, in which the embryos develop, are on average about 1.2 millimeters long and have a spindle-shaped structure with approximately 0.2 millimeters wide. At the pointed end are, as with other Demoiselles also a hole structure ( Mikropylenapparat ) with four holes to enable penetration of the sperm of the male. In addition, the egg of the banded demoiselle at the front end a funnel-like appendix unknown object, which projects at the inserted egg outwardly from the plant stem. The color of the egg changes from a bright yellow when freshly laid eggs on a yellow-brown to reddish brown when older egg. Within the egg takes place, the embryonic development of the dragonfly. For the first time this has been described for the blue-winged demoiselle 1869, but it represented the first description of the embryonic development of an insect at all. From outside the progression of the development by a slight change in length as well as by changing the shape is recognizable. It bulges on the upper part of the egg slightly, while the lower part deforms concave. The development itself can be divided into three sections: the early development, when it forms after fertilization of the ovum by dividing the basic shape of body Definitely the development with the final formation of the body shape until they hatch from the egg the larval development of the hatched larva up to the formation of the winged imago The embryo in the egg can last between 20 days and one month.

The larval development of the Blue-winged demoiselle takes into Middle Eastern waters, usually between six and nine weeks, mainly due to the preference of cooler waters, it is usually somewhat longer than that of the banded demoiselle. At the end of larval development, it comes to winter and the development until the following year with the metamorphosis to the imago completed (univoltine development). The cooler water is a breeding, the greater the proportion of larvae that pass through the two winter periods and therefore a development of nearly two years (semivoltine development). Studies have shown that this might modify the relationship between univoltine and semivoltinen larvae within a body of water and clear in the course of the river and increase the water temperature moves toward univoltiner larvae.

Like all these predatory dragonfly larvae live. They feed primarily on insect larvae such as those of the black flies, midges, stoneflies and mayflies, as well as amphipods. They are defending their seats against other dragonfly larvae, especially those of its own kind.

The larvae are much more sensitive to changes in habitat than the banded demoiselle, especially to temperature fluctuations. Already after a few days deprivation increases mortality rapidly, and after again prevail acceptable oxygen conditions, it is still too long after, birth defects and an increased mortality rate among affected animals. This is mainly because they absorb the oxygen from the water inefficient. Was able to detect in experiments that even larvae of the banded demoiselle, who had been removed completely Tracheenkiemenblätter, under normal circumstances are still less sensitive to fluctuations in the oxygen supply. The inefficiency of oxygen uptake is balanced by the choice of habitat, since both increased flow and cooler water absorption capacity.

Conservation

Detailed view of a female
Beautiful Demoiselle

Since the blue wing-demoiselle due to their very narrow ecological requirements ( Stenökie ) can occur, especially the larvae only in waters that are characterized by a little influenced by man and natural water bodies, it is the largest part of their range is very rare. It is absent in areas corresponding to major cities or industrial centers completely, and even in regions with strongly pronounced agricultural use it is to be found only rarely. According to this situation it is in Germany in the Red Data Book (1998) classified as endangered in some states it is even in danger of extinction. Similarly in Austria, Switzerland and other Central European countries.

Among the factors that make a settlement of the water for the larvae of the blue-wing Demoiselle impossible to include on the one hand, the channeling and obstruction of the same, go where the lost for the settlement of important aquatic plants. On the other hand, the eutrophication of water by agriculture and by household wastewater causes an important factor in the decline dar. this to increased sludge formation and therefore increased oxygen consumption in the affected waters and to increased algal growth of so-called " slime algae ". It is brown and green algae , the water plant and the substrate is overgrown. The veralgten plants are not accepted by the females as oviposition sites. In addition, the larvae no holding facilities are against the current, and the algae and dirt particles settle to the gill lamellae are important for respiration. The algae is followed by weeds and ultimately a silting of water bodies.

But natural waters with low water pollution can be in a state of the animals is not available. He may receive a water surface is not completely from the plants of the marginal vegetation to be overgrown, this is done mainly by fast-growing plants such as Meadowsweet ( Filipendula ulmaria ), the stinging nettle ( Urtica dioica ) or Himalayan balsam ( Impatiens glandulifera ). The tree growth on the waters edge should not report closed canopy, otherwise lack the necessary sunlight. Above all streams in uncultivated pastures, where no regular mowing is taking place, according to the animals are not habitable. This can be countered by regular removal of boundary vegetation, which will also not be complete. Even a partial thinning of trees and shrubs should be performed. In intensively used agricultural areas with a regular input of manure as fertilizer is an a few meters wide can prevent extensive or unmanaged riparian strips one Einschwemmung and thus act against eutrophication.

Systematics

Calopteryx virgo meridionalis

The blue-wing Demoiselle is a day of about 20 known species of the genus Calopteryx dar. However, a comprehensive systematic revision in the genus Calopteryx is long overdue, to clarify a number of contentious points currently on the authorization of individual species or subspecies. In addition to the blue-wing Demoiselle three other species in Europe are represented, with the Bronze demoiselle ( Calopteryx haemorrhoidalis ) and the Southwest demoiselle ( Calopteryx xanthostoma happen) only two species in southern Europe. All other species are distributed over the Holarctic and are accordingly to be found in North America and Asia. The sister species of blue-wing Demoiselle represents probably represents the Bronze demoiselle, according to molecular biological studies revealed for the European species the following relationship.[2]

Within each species different subspecies are discussed, which differ based primarily of dyeings. Also, hybrids between species and appear to be possible, but were rarely documented.

See also

References

  1. ^ See "dissemination". In: Klaus Sternberg, Rainer Buchenwald . dragonflies Baden-Württemberg, Volume 1 Eugen Ulmer Verlag, Stuttgart 2000, p 203 ISBN 3-8001-3508-6 .
  2. ^ B. Misof, CL Anderson, H. Hadrys: A phylogeny of the damselfly genus Calopteryx (Odonata) using mitochondrial 16S rDNA markers. in: Molecular Phylogenetics and Evolution. Academic Press, Orlando Fla. 15.2000, 1, 5-14 (PDF version). ISSN 10,959,513

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!