Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasiommata maera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACATCCCTTAGTCTTATTATTCGAACAGAATTAGGTAACCCAGGATTCTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATCATAATTGGAGGATTTGGCAATTGATTAATTCCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTGTTACCTCCTTCTTTAATTTTATTAATTTCAAGTAGTATCGTAGAAAATGGAGCAGGAACAGGATGAACTGTATACCCCCCTCTTTCATCTAACATTGCTCACAGAGGATCCTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGCGCTATTAATTTTATTACAACCATTATTAATATACGAATTAATAATTTATCCTATGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCCCTTCTTCTTTTACTTTCTTTACCTGTTTTAGCAGGAGCTATCACTATACTTTTAACAGATCGAAATTTAAATACTTCTTTCTTTGACCCTGCCGGAGGAGGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGANNNNNNTATTTTAATTTTACCTGGATTTGGAATAATCTCTCATATTATTTCCCAAGAAAGAGGTAAAAAAGAAACTTTTGGATATTTAGGTATAATTTATGCTATATTAGCAATTGGACTATTAGGATTTATTGTATGAGCTCATCACATATTTACAGTAGGTATAGATATTGATACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasiommata maera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 65
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lasiommata maera

The Large Wall Brown (Lasiommata maera) is a butterfly in the family Nymphalidae. The species is common in continental Europe. Though it is an avid flier It is seldom seen on flight in strong wind. Its preferred habitats are edges of the forests and unmanaged clearings on forested areas. The larva eats full-grown grasses, such as Poa annua and Festuca pratensis.

Male
Female


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!