Overview

Brief Summary

The cosmopolitan Brown Dog Tick (R. sanguineus) can transmit the Rickettsia bacteria that cause Rocky Mountain spotted fever and boutonneuse fever. This small, elongated, red-brown tick is unusual in that it can complete its entire life cycle indoors, facilitating its spread around the world. Although R. sanguineus will feed on a wide variety of mammals (including humans), in the United States dogs are the preferred host and appear to be required to develop large infestations. (Lord 2001).

As a 3-host tick, R. sanguineus drops off its host between developmental stages (larva, nymph, and adult), although if few hosts are available it is likely to re-attach to the same individual. After feeding on a host for around a week, an adult female drops off and finds a protected site while her eggs develop. She may begin laying eggs in around four days and may continue for two weeks, after which she dies. A well-fed adult female can lay up to 5,000 eggs. Larvae hatch two to five weeks later and search out a host. Once on a host, a larva feeds for three to seven days, then drops off and take about two weeks to develop into a nymph. After finding a host, a nymph feeds for five to ten days before dropping off and taking about two weeks to develop into an adult. As adults, males feed for only short periods. The entire life cycle can be completed in just over two months, but if hosts are difficult to locate or temperature is low it takes longer. These ticks can live as long as three to five months in each stage without feeding. (Lord 2001).

In the United States, R. sanguineus can transmit canine erlichiosis (caused by Ehrlichia canis) and canine babesia (caused by Babesia canis) to dogs. In parts of Europe, Asia, and Africa, these ticks transmit Rickettsia conorii, which causes boutonneuse fever. Rhipicephalus sanguineus is not known to transmit Lyme disease. (Lord 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Canis familiaris

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Felis

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Bos taurus (domestic)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Water absorbed from humid air: brown dog tick
 

The mouths of ticks absorb water vapor from the atmosphere by secreting a hydrophilic solution.

   
  "The ability to absorb water vapor from the atmosphere enables ticks to survive without drinking water for many months. The tick rehydrates using a three-stage process. First, it uses its foremost pair of legs to detect microregions of high humidity, such as those surrounding water droplets. Once a suitable water source is detected, the tick secretes a hydrophilic solution from its mouth. Once it is saturated, the tick draws the now hydrated secretion back into its mouth. The secretion is a hygroscopic salt solution. Once ejected from the mouth, the solution dries at low ambient humidities, leaving a crystalline substance behind. When the humidity increases, the hydrophilic crystalline substance dissolves and is swallowed back into the body of the tick. The adaptation allows exophilic ticks to absorb water vapor from close to saturation down to 43% relative humidity. Mites and soil-dwelling arachnids use a similar mechanism to absorb water vapor. This strategy might inspire innovation in the development of desiccants, building envelope design, and HVAC engineering." (Biomimicry Guild unpublished report)

"The salivary glands are the organs of osmoregulation in ticks and, as  such, are critical to the biological success of ticks both during the  extended period off the host and also during the feeding period on the  host. Absorption of water vapour from unsaturated air into hygroscopic  fluid produced by the salivary glands permit the tick to remain hydrated  and viable during the many months between blood-meals. When feeding,  the tick is able to return about 70% of the fluid and ion content of the  blood-meal into the host by salivation into the feeding site. This  saliva also contains many bioactive protein and lipid components that  aid acquisition of the blood-meal. The salivary glands are the site of  pathogen development and the saliva the route of transmission. The  importance of the multifunctional salivary glands to tick survival and  vector competency makes the glands a potential target for intervention." (Bowman and Sauer 2004:S67)
  Learn more about this functional adaptation.
  • Gaede K; Knülle W. 1997. On the mechanism of water vapour sorption from unsaturated atmospheres by ticks. Journal of Experimental Biology. 200(10): 1491-1498.
  • Bowman AS; Sauer JR. 2004. Tick salivary glands: functions, physiology and future. Parasitology. 129: S67-S81.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Rhipicephalus sanguineus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Rhipicephalus sanguineus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTACCGCGATGAATATACTCTACTAACCATAAAGACATTGGAACAATATATTTAATTTTTGGAGCATGATCAGGTATATTAGGACTTAGTATAAGAATATTAATTCGTATAGAATTAGGACAACCTGGAACTTTAATTGGAAATGATCAGATTTATAATGTAATCGTAACAGCACATGCATTTATTATAATTTTCTTTATAGTTATACCAATCATAATCGGAGGGTTCGGAAATTGATTAGTTCCTATTATATTAGGTGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCATTATTTTTATTGATTAACTCTTCATTAATTGAATCCGGAGCTGGAACAGGATGAACAGTTTATCCCCCTCTATCTTCAAATTTATCACATTATGGTCCATCAGTAGATTTAGCTATTTTTTCTCTTCACCTTGCTGGTGCTTCTTCAATTTTAGGTGCAATTAACTTCATCACAACTATTGTAAATATACGATCAATTGGAATAACAATAGAACGAATACCATTATTTGTTTGATCTGTTTTAATTACAGCTATTTTACTACTTCTATCTTTACCTGTATTAGCAGGTGCCATTACAATATTATTAACTGATCGAAACTTTAACACATCATTTTTTGATCCTTCAGGAGGAGGAGATCCCATTTTATATCAACACTTATTTTGATTCTTTGGCCATCCTGAAGTATATATTTTAATTTTACCAGGTTTTGGTATAATTTCTCAAATTATTTGTTACAATACAGGTAAAAAAGAGCCTTTTGGGAATTTAGGTATAATTTATGCCATAGCAGCAATTGGATTACTAGGATTTATTGTGTGAGCTCACCATATATTTACAGTTGGTATAGATGTAGACACTCGAGCTTATTTTACCTCAGCTACAATAATTATCGCAGTACCTACTGGAATTAAAATTTTTAGTTGATTAGCCACTTTACATGGTTCTCATATTAAATTTAATACTTCAATTTTATGAGCTTTAGGTTTTGTATTTTTATTTACAGTAGGGGGCTTAACAGGAATTATATTAGCTAATTCTTCAATCGATATTGTTTTACATGATACTTATTACGTAGTGGCTCATTTTCATTATGTTCTATCAATAGGAGCAGTATTTGGTATTATAGGGGCTATTATTCATTGATTTCCAATATTCTTGGGTTTAAATTTAAATTCAATATTAACAAAAGTTCAATTTATAATTACATTCATTGGCGTTAATTTAACTTTTTTTCCGCAACATTTTTTAGGTTTAGCCGGTATACCACGTCGTTATTCAGATTATCCAGACTTTTTTACTAAATGAAATTTTATTTCTTCTTTAGGATCTCTTATTTCTCTTATAGGAGTTATTATACTAATTATTATTATTTGAACTAGAATTATTGAAAAAAAAATAATCAATTTTTCTTCATTTACTAATTCATCTATCGAATGAATACTAAATTTCCCTCCATCAGAACATTCTTTCAATCAAAATAATATTATTCTTAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rhipicephalus sanguineus

The brown dog tick, Rhipicephalus sanguineus, is a species of tick which is found worldwide, but more commonly in warmer climates. This species is unusual among ticks in that its entire life cycle can be completed indoors.[1]

Hosts[edit]

Rhipicephalus sanguineus will feed on a wide variety of mammals, but dogs are the preferred host in the U.S., and the population can reach pest proportions in houses and kennels.[1]

Medical importance[edit]

R. sanguineus is one of the most important vectors of diseases in dogs worldwide.[2] In the United States, R. sanguineus is a vector of the diseases in dogs: canine ehrlichiosis (Ehrlichia canis) and canine babesiosis (Babesia canis). In dogs, symptoms of canine ehrlichiosis include lameness and fever; those for babesiosis include fever, anorexia and anemia. R. sanguineus has not been shown to transmit the bacteria which causes Lyme disease in humans.[1] In parts of Europe, Asia and Africa, it is a vector of Rickettsia conorii, known locally as Mediterranean spotted fever, boutenneuse fever, or tick typhus.[1]

R. sanguineus can also transmit Rocky Mountain spotted fever in humans in the southwestern United States.[3]

Management[edit]

The best management strategy is prevention of infestations in the house or kennel. In addition, the earlier the infestation is discovered, the easier it is to control. Regular grooming and inspection of pets is essential to management, especially when dogs have been quartered or have interacted with other dogs.[1]

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!