Overview

Brief Summary

North American Ecology (US and Canada)

Resident on small range in interior California (Scott 1986). Habitats are HUDSONIAN ZONE MEADOW. Host plants are usually shrubs in family Salicaceae. There is one flight each year with the approximate flight time JUL15-AUG15 (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (<100-250 square km (less than about 40-100 square miles)) Restricted to the Sierra Nevada at high altitudes, mainly above 9000', between Tuolumne and Tulare Counties, California (Ferris, 1988; Opler, 1999). Northernmost point of distribution is near Tower Peak at the northern boundary of Yosemite National Park (Opler, personal observation).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Moist alpine and subalpine meadows surrounded by low shrubs including those of the caterpillar host plants shrub willow or dwarf billberry (VACCINIUM CESPITOSUM)(Garth and Tilden, 1963; Scott, 1986; Opler, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Caterpillars eat the leaves of shrub willow or dwarf billberry (VACCINIUM CESPITOSUM)(Garth and Tilden, 1963; Scott, 1986; Opler, 1999). Adults nectar at various low flowers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Adults have a single flight in July and August (Ferris, 1988). Winter is passed by young caterpillars. The possibility exists that as for many alpine and subalpine species, two years may be necessary to complete the life cycle.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colias behrii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCCCCTCTTTCCTCTAATATTGCCCATAGAGGATCTTCTGTTGATTTA---GCTATTTTTTCTCTTCATCTTGCAGGAATTTCCTCTATCCTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTATTATTATTATCATTGCCAGTTTTAGCTGGT---GCAATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACACCCCGAAGTATATATTCTAATTTTACCAGGATTTGGTATAATTTCACATATAATTTCTCAAGAAAGAGGGAAAAAA---GAAACTTTTGGATCTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGATATTGATACTCGAGCTTATTTCACCTCAGCAACTATAATTATTGCTGTACCTACAGGTATTAAAATTTTTAGTTGATTA---GCAACATTATATGGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Colias behrii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Restricted to high alpine meadows of California's Sierra Nevada. Thus a very limited range. . In general common at high enough altitudes within this tiny range. Some occurrences are protected. Likely to be vulnerable to climate change given shortage of higher refugia and limited range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Summer cattle grazing of US Forest Service lands may be a threat, but usually not so high in elevation. Trampling of meadows by domestic livestock and hikers. Introduction of alien weeds is a less serious threat. Climate change probably is the greatest current threat. This butterfly is already confined to high altitudes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: National Park in part, USFS other parts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Colias behrii

Colias behrii, the Behr's Sulphur or Sierra Green Sulfur, is a butterfly in the Pieridae family. It is endemic to California's Sierra Nevada from Tuolumne County south to Tulare County.[2]

The wingspan is 35–42 mm (1.4–1.7 in). The upper surface of the males is dull green with a dark border and with a pale hindwing cell spot. Females are greenish-yellow with a dark diffuse border. The underside of both sexes is green. Adults are on wing from July to August.. They feed on flower nectar.[2]

The larvae feed on Vaccinium species and Gentiana newberryi.[2]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!