Overview

Brief Summary

North American Ecology (US and Canada)

Resident in western North America (Scott 1986). Habitats are NATURAL, SOMETIMES DISTURBED, OPEN AREAS. Host plants are usually herbaceous including many species, but mostly in one family, Cruciferae. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There is a variable number of flights based on latitude each year with the approximate flight time JUN1-JUL1 in the northern part of the range and MAY1-JUN1 in the southern part of their range (Scott 1986). Listed as a subspecies of Pieris callidice by some sources (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

The Western White along with the other two Pontia whites, form a group of very similar species. The Spring White (Pontia sisymbrii) is easiest to distinguish; the dark vein markings on the hindwing underside are not connected laterally, and it occurs only in montane woodlands and extreme northern Alberta. The Western and Checkered White (P. protodice) are more difficult to separate. Males of the Western are more heavily marked than the Checkered, particularly on the underside. Females of both species have heavier markings than the males, but these markings are brown in P. protodice, not charcoal or black. Another characteristic is found on the underside of the forewing apex: P. occidentalis has the dark submarginal band connected with dark markings along the veins to the wing margin, P. protodice has only pale yellow scales here. Individuals of the spring generation are smaller and have darker underside markings. Alberta populations are the nominate subspecies.  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The Western White ranges from Alaska to western Ontario, south to California and New Mexico (Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Alaska and British Columbia to Manitoba; south between Pacific Coast Ranges and eastern Rockies to central California, New Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Non-forested habitats throughout the province, particularly grasslands and alpine meadows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: All sunny mountain habitats; also lowlands in clearings, fields, and roadsides.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Although this is often a very common species, there are no larval foodplant records for Alberta. Wild mustards (Brassicaeae) are recorded elsewhere, including Lepidium, Cleome, Draba, Sisymbrium and Thlaspi (Layberry et al. 1998, Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Single- to multi-brooded, depending on the habitat, flying from April into September.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The eggs are a dull orange colour. Mature larvae are blue-grey with a yellow dorsal and lateral stripe, and many black dots. Pupae are light grey with small black spots, and overwinter (Layberry et al. 1998, Guppy & Shepard 2001). Males display hilltopping behaviour, and can sometimes be found on mountain peaks over 3000m. In the mountains, there is only one brood that emerges in late spring, but there are two (sometimes a partial third) broods at lower elevations (Bird et al. 1995). This is our most common species of Pontia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pontia occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATCCGAACTGAATTAGGTAATCCAGGATTTTTAATTGGAGAT---GATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGTAATTGACTTGTCCCTCTGATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCACCTTCTTTAACCCTTCTAATTTCAAGTAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGCCCATAGAGGATCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATCAATTTCATTACAACTATTATTAATATACGAATTAGAAATATATCATTTGATCAAATACCCTTATTTGTTTGAGCAGTAGGAATTACTGCATTACTTTTACTTCTTTCTTTACCTGTTCTTGCTGGAGCTATTACTATACTCTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pontia occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None, common weedy species in many areas of western North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pontia occidentalis

The Western White (Pontia occidentalis) is a butterfly in the family Pieridae. It is found in Western North America.

The wingspan is 38 to 53 millimeters. The host plants are from the Brassicaceae (mustard or cabbage) family. The caterpillars eat especially the flowers, buds and fruit. In the north of the range, one generation flies in June and July; in the south two generations fly from May to August.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Sometimes difficult to distinguish from P. protodice althought the two are distinct. Sometimes considered conspecific with the Eurasian P. callidice.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!