Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Resident in southern North America migratory to the north (Scott 1986). Habitats are OPEN AREAS, INCLUDING DESERT, PLAINS AND DISTURBED AREAS. Host plants are usually herbaceous including many species, but mostly in one family, Cruciferae. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are multiple flights each year with the approximate flight time MAR15-NOV30 depending on latitude (Scott 1986). Considered Pieris protodice by Scott (1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The Checkered White and the other two Pontia whites can be a challenge to identify. The Spring White (Pontia sisymbrii) is easiest to distinguish; the dark vein markings on the hindwing underside are not connected laterally, and it occurs only in montane woodlands and extreme northern Alberta. The Western and Checkered White (P. protodice) are more difficult to separate. Males of occidentalis are more heavily marked than protodice, particularly on the underside. Females of both species have heavier markings than the males, but these markings are brown in protodice, not charcoal or black. Another characteristic is found on the underside of the forewing apex: P. occidentalis has the dark submarginal band connected with dark markings along the veins to the wing margin, P. protodice has only pale yellow scales here. There are no named subspecies. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

A species of the southern US and Mexico, occasionally found as far north as the Peace River region in the west and southern Quebec in the east (Layberry et al. 1998, Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southern Canada south to northern Mexico. Absent from Pacific northwest. Absent in modern times in New England--the few old specimens do not suggest it was ever resident there. Increasingly erratic east of the Appalachians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Grasslands and meadows in the prairie and parkland regions.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Virtually any disturbed dry open area such as vacant lots, railroads, airports, dry grassland, deserts and cities. Sometimes in sparsely wooded areas but not in heavy shade.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larval hosts in Alberta are not known. They are likely to be a variety of wild and cultivated mustards (including cabbage and turnip), which are used as food plants elsewhere (Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Pontia protodice in Illinois

Pontia protodice Boisduval & LeConte: Pieridae, Lepidoptera
(observations are from Robertson, Graenicher, Fothergill & Vaughn; this butterfly is the Checkered White)

Apiaceae: Erigenia bulbosa sn (Rb), Erynigum yuccifolium sn (Rb); Asteraceae: Aster anomalus sn (Rb), Aster drummondii sn (Gr), Aster laevis sn (Gr), Aster lanceolatus sn (Rb, Gr), Aster novae-angliae sn (Rb), Aster pilosus sn fq (Rb), Aster puniceus sn (Gr), Boltonia asterioides sn (Rb), Cirsium arvense sn (Gr), Cirsium vulgare sn (Rb), Coreopsis palmata sn (Rb), Echinacea pallida sn (Rb), Echinacea purpurea sn (Rb), Eupatoriadelphus purpureus sn (Rb), Eupatorium altissimum sn (Rb), Eupatorium serotinum sn (Rb), Heliopsis helianthoides sn (Rb), Rudbeckia subtomentosa sn (Rb), Rudbeckia triloba sn (Rb), Silphium perfoliatum sn (Rb), Taraxacum officinale sn (FV); Boraginaceae: Myosotis verna sn (Rb); Brassicaceae: Capsella bursa-pastoris sn (Rb), Lepidium virginicum sn (Rb); Campanulaceae: Lobelia spicata sn (Rb); Caryophyllaceae: Saponaria officinalis sn (Rb); Dipsacaceae: Dipsacus fullonum sn (Rb); Euphorbiaceae: Euphorbia corollata sn (Rb); Fabaceae: Melilotus alba sn (Rb), Orbexilum onobrychis sn np (Rb), Trifolium pratense sn (Rb), Trifolium repens sn (Rb); Lamiaceae: Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Marrubium vulgare sn fq (Rb), Monarda fistulosa sn (Rb), Nepeta cataria sn fq (Rb), Prunella vulgaris sn (Rb), Pycnanthemum pilosum sn (Rb), Pycnanthemum tenuifolium sn (Rb), Pycnanthemum virginianum sn (Rb); Lythraceae: Ammannia coccinea sn (Rb), Lythrum alatum sn fq (Rb); Malvaceae: Malva neglecta sn (Rb), Sida spinosa sn (Rb); Onagraceae: Oenothera pilosella sn (Rb); Oxalidaceae: Oxalis corniculata sn (Rb); Polygonaceae: Persicaria pensylvanica sn (Rb), Persicaria vulgaris sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Prunus americana sn fq (Rb), Rubus allegheniensis sn (Rb); Rubiaceae: Cephalanthus occidentalis sn fq (Rb), Houstonia lanceolata sn (Rb); Verbenaceae: Verbena hastata sn (Rb), Verbena stricta sn (Rb), Verbena urticifolia sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

A single brood annually, which flies in mid July to mid August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Guppy & Shepard (2001) summarize the appearance of the immature stages as follows: the egg is orange, and mature larvae are black dotted and bluish green to grey with a yellow dorsal, lateral and sublateral stripe. The pupa overwinters, and varies in colour from blue-grey to cream. The Checkered White is rare in Alberta, only occasionally appearing as a migrant from the southern U.S. There are no spring records for this species in Alberta (Bird et al. 1995), so it likely does not survive our winters (Scott 1986). Colonies are occasionally established for several years in southern Ontario north to the Ottawa Valley (Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pontia protodice

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAACCGAATTAGGTAACCCAGGATTCCTAATTGGAGATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCCCTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACTCTTCTAATTTCAAGTAGAATCGTCGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCACTTTCTTCTAATATTGCTCATAGAGGTTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCATTTGATCAAATACCTTTATTTGTCTGAGCAGTAGGAATTACTGCTTTACTTTTACTTCTTTCTTTACCTGTTCTTGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pontia protodice

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Drastic decline in the Middle Atlantic region and apparently as far south as the Carolinas and Georgia. No longer appears widely most years northeast of the Carolinas except for one persistent colony in northern New Jersey and around New York City. Decline seems sufficient to make a rank of "demonstrably secure" no longer tenable since it is not now predictable whether the decline will spread westward or not. The species is apparently secure in the western USA for now. No state Natural Heritage Programs east of the Appalachians rank this species as demonstrably secure any more, not even Georgia or Florida. It still frequently reaches northern Indiana and parts of Ohio or did in the 1990s.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Other Considerations: The causes of the decline eastward are not clear. Suspects include competition or more likely parasite or pathogen spill over from the introduced PIERIS RAPAE and introduced exotic crucifers toxic to larvae on which females waste eggs. Loss of habitat is almost certainly not the cause.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Global Long Term Trend: Decline of 30-70%

Comments: Seems secure westward, but a major decline eastward seems to be accelerating and the species is absent most years now in eastern Pennsylvania, southern New Jersey, and Delaware (Schweitzer, pers. obs. 1964-2000). C. Ludwig and S. Hall (pers. comm. to Schweitzer) point out it is now scarce even in Virginia and most of the Carolinas. In New Jersey it seems very persistent and at times abundant at Newark International Airport even in years when no others are observed in or anywhere near the state, but is not known to occur regularly anywhere else in the 13 state northeastern region except spottily in and immediately adjacent to New York City. No actual southern New Jersey specimens since about 1964. The species was very common there for many years through the 1950s. There was one credible report there in the 1990s and at least one in spring 2000. Brock and Kaufman (2003) map it as uncommon in the entire eastern portion of the United States except Florida, although it certainly is less rare west of the Appalachians than east of them. So has declined significantly in about half the range and to extirpation as a resident in perhaps 15%. No reports of decline in western USA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Unknown

Comments: Severely threatened or gone eastward but seemingly doing ok in west. Threats probably include exotic parasitoids associated with, and perhaps even direct competition from, the exotic Pieris rapae. Habitat loss does not seem a plausible explanation although the increase of lawns, asphalt and forest in the Northeast have contributed a little. Notably northeastward this species persists in areas where almost no other butterflies and not much of anything else can persist, strongly suggesting it is limited by biotic factors. Also all native Pieridae have declined in most of the east--this one more than the rest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Needs: None, common weedy species westward and no apparent way to protect it eastward where decline is pervasive. Perhaps worthwhile to protect the now isolated New Jersey EO.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!