Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Resident in southern North America migratory to the north (Scott 1986). Habitats are OPEN AREAS, INCLUDING DESERT, PLAINS AND DISTURBED AREAS. Host plants are usually herbaceous including many species, but mostly in one family, Cruciferae. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are multiple flights each year with the approximate flight time MAR15-NOV30 depending on latitude (Scott 1986). Considered Pieris protodice by Scott (1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The Checkered White and the other two Pontia whites can be a challenge to identify. The Spring White (Pontia sisymbrii) is easiest to distinguish; the dark vein markings on the hindwing underside are not connected laterally, and it occurs only in montane woodlands and extreme northern Alberta. The Western and Checkered White (P. protodice) are more difficult to separate. Males of occidentalis are more heavily marked than protodice, particularly on the underside. Females of both species have heavier markings than the males, but these markings are brown in protodice, not charcoal or black. Another characteristic is found on the underside of the forewing apex: P. occidentalis has the dark submarginal band connected with dark markings along the veins to the wing margin, P. protodice has only pale yellow scales here. There are no named subspecies. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

A species of the southern US and Mexico, occasionally found as far north as the Peace River region in the west and southern Quebec in the east (Layberry et al. 1998, Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southern Canada south to northern Mexico. Absent from Pacific northwest. Absent in modern times in New England--the few old specimens do not suggest it was ever resident there. Increasingly erratic east of the Appalachians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Grasslands and meadows in the prairie and parkland regions.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Virtually any disturbed dry open area such as vacant lots, railroads, airports, dry grassland, deserts and cities. Sometimes in sparsely wooded areas but not in heavy shade.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larval hosts in Alberta are not known. They are likely to be a variety of wild and cultivated mustards (including cabbage and turnip), which are used as food plants elsewhere (Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Pontia protodice in Illinois

Pontia protodice Boisduval & LeConte: Pieridae, Lepidoptera
(observations are from Robertson, Graenicher, Fothergill & Vaughn; this butterfly is the Checkered White)

Apiaceae: Erigenia bulbosa sn (Rb), Erynigum yuccifolium sn (Rb); Asteraceae: Aster anomalus sn (Rb), Aster drummondii sn (Gr), Aster laevis sn (Gr), Aster lanceolatus sn (Rb, Gr), Aster novae-angliae sn (Rb), Aster pilosus sn fq (Rb), Aster puniceus sn (Gr), Boltonia asterioides sn (Rb), Cirsium arvense sn (Gr), Cirsium vulgare sn (Rb), Coreopsis palmata sn (Rb), Echinacea pallida sn (Rb), Echinacea purpurea sn (Rb), Eupatoriadelphus purpureus sn (Rb), Eupatorium altissimum sn (Rb), Eupatorium serotinum sn (Rb), Heliopsis helianthoides sn (Rb), Rudbeckia subtomentosa sn (Rb), Rudbeckia triloba sn (Rb), Silphium perfoliatum sn (Rb), Taraxacum officinale sn (FV); Boraginaceae: Myosotis verna sn (Rb); Brassicaceae: Capsella bursa-pastoris sn (Rb), Lepidium virginicum sn (Rb); Campanulaceae: Lobelia spicata sn (Rb); Caryophyllaceae: Saponaria officinalis sn (Rb); Dipsacaceae: Dipsacus fullonum sn (Rb); Euphorbiaceae: Euphorbia corollata sn (Rb); Fabaceae: Melilotus alba sn (Rb), Orbexilum onobrychis sn np (Rb), Trifolium pratense sn (Rb), Trifolium repens sn (Rb); Lamiaceae: Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Marrubium vulgare sn fq (Rb), Monarda fistulosa sn (Rb), Nepeta cataria sn fq (Rb), Prunella vulgaris sn (Rb), Pycnanthemum pilosum sn (Rb), Pycnanthemum tenuifolium sn (Rb), Pycnanthemum virginianum sn (Rb); Lythraceae: Ammannia coccinea sn (Rb), Lythrum alatum sn fq (Rb); Malvaceae: Malva neglecta sn (Rb), Sida spinosa sn (Rb); Onagraceae: Oenothera pilosella sn (Rb); Oxalidaceae: Oxalis corniculata sn (Rb); Polygonaceae: Persicaria pensylvanica sn (Rb), Persicaria vulgaris sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Prunus americana sn fq (Rb), Rubus allegheniensis sn (Rb); Rubiaceae: Cephalanthus occidentalis sn fq (Rb), Houstonia lanceolata sn (Rb); Verbenaceae: Verbena hastata sn (Rb), Verbena stricta sn (Rb), Verbena urticifolia sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

A single brood annually, which flies in mid July to mid August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Guppy & Shepard (2001) summarize the appearance of the immature stages as follows: the egg is orange, and mature larvae are black dotted and bluish green to grey with a yellow dorsal, lateral and sublateral stripe. The pupa overwinters, and varies in colour from blue-grey to cream. The Checkered White is rare in Alberta, only occasionally appearing as a migrant from the southern U.S. There are no spring records for this species in Alberta (Bird et al. 1995), so it likely does not survive our winters (Scott 1986). Colonies are occasionally established for several years in southern Ontario north to the Ottawa Valley (Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pontia protodice

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAACCGAATTAGGTAACCCAGGATTCCTAATTGGAGATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCCCTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACTCTTCTAATTTCAAGTAGAATCGTCGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCACTTTCTTCTAATATTGCTCATAGAGGTTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCATTTGATCAAATACCTTTATTTGTCTGAGCAGTAGGAATTACTGCTTTACTTTTACTTCTTTCTTTACCTGTTCTTGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pontia protodice

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Drastic decline in the Middle Atlantic region and apparently as far south as the Carolinas and Georgia. No longer appears widely most years northeast of the Carolinas except for one persistent colony in northern New Jersey and around New York City. Decline seems sufficient to make a rank of "demonstrably secure" no longer tenable since it is not now predictable whether the decline will spread westward or not. The species is apparently secure in the western USA for now. No state Natural Heritage Programs east of the Appalachians rank this species as demonstrably secure any more, not even Georgia or Florida. It still frequently reaches northern Indiana and parts of Ohio or did in the 1990s.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Other Considerations: The causes of the decline eastward are not clear. Suspects include competition or more likely parasite or pathogen spill over from the introduced PIERIS RAPAE and introduced exotic crucifers toxic to larvae on which females waste eggs. Loss of habitat is almost certainly not the cause.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Global Long Term Trend: Decline of 30-70%

Comments: Seems secure westward, but a major decline eastward seems to be accelerating and the species is absent most years now in eastern Pennsylvania, southern New Jersey, and Delaware (Schweitzer, pers. obs. 1964-2000). C. Ludwig and S. Hall (pers. comm. to Schweitzer) point out it is now scarce even in Virginia and most of the Carolinas. In New Jersey it seems very persistent and at times abundant at Newark International Airport even in years when no others are observed in or anywhere near the state, but is not known to occur regularly anywhere else in the 13 state northeastern region except spottily in and immediately adjacent to New York City. No actual southern New Jersey specimens since about 1964. The species was very common there for many years through the 1950s. There was one credible report there in the 1990s and at least one in spring 2000. Brock and Kaufman (2003) map it as uncommon in the entire eastern portion of the United States except Florida, although it certainly is less rare west of the Appalachians than east of them. So has declined significantly in about half the range and to extirpation as a resident in perhaps 15%. No reports of decline in western USA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Unknown

Comments: Severely threatened or gone eastward but seemingly doing ok in west. Threats probably include exotic parasitoids associated with, and perhaps even direct competition from, the exotic Pieris rapae. Habitat loss does not seem a plausible explanation although the increase of lawns, asphalt and forest in the Northeast have contributed a little. Notably northeastward this species persists in areas where almost no other butterflies and not much of anything else can persist, strongly suggesting it is limited by biotic factors. Also all native Pieridae have declined in most of the east--this one more than the rest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Needs: None, common weedy species westward and no apparent way to protect it eastward where decline is pervasive. Perhaps worthwhile to protect the now isolated New Jersey EO.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pontia protodice

The Checkered White (Pontia protodice), also called Southern Cabbage Butterfly, is a common North American butterfly in the family Pieridae. Its green larva is a type of cabbage worm.

Description[edit]

female
male
Underside of the male

The upper side of the wings are white and marked with black and gray, more so on the female than on the male. The underside of the hindwings are marked with extensive yellow-brown veins. The wingspan is 1.25-1.75 in. In its pre-adult form, the egg is orange, and mature larvae are black dotted and bluish green to grey with a yellow dorsal, lateral and sublateral stripe. The pupa overwinters, and varies in colour from blue-grey to cream.[3]

Distribution[edit]

Pontia protodice is most commonly found in the southern parts on the United States along with some of the northern areas of Mexico. Occasionally the species can be found in the northern parts of the U.S. and southern Canada.[4] It is absent from the Pacific Northwest and the New England area, although populations have become increasingly erratic just east of the Appalachians.[3]P. protodice are most widespread in late summer and autumn, not earlier in the season.[5]

Habitat[edit]

Habitats are open areas, including desert, plains, and disturbed areas. Virtually any disturbed dry open area such as vacant lots, railroads, airports, dry grassland, deserts, and cities are potential areas of inhabitation. In addition, populations may sometimes be found in sparsely wooded areas, grasslands, and meadows in the prairie and parkland regions, usually in areas without heavy shade.[3]Though it may seem these species of butterfly inhabit a wide range of environments, they have been found to be absent from certain counties for many years at a time.[6]


Nectar plants[edit]

Checkered Whites have been seen nectaring on mustards, composites, and alfalfa.

Host plants[edit]

larva

Its host plants include Brazos Rockcress (Arabis petiolaris), Sicklepod (Senna obtusifolia), Black Mustard (Brassica nigra), Broccoli (Brassica oleraceae italica), Brussel Sprouts (Brassica oleraceae gemmifera), Cabbage (Brassica oleraceae capitata), Cauliflower (Brassica oleraceae botrytis), Turnip (Brassica rapa), Pinnate Tansy-Mustard (Descurainia pinnata), Fixweed Tansy-Mustard (Descurainia sophia), Prairie Pepperweed (Lepidium densiflorum), Virginia Pepper-Grass (Lepidium virginicum), Radish (Raphanus sativus), Tumble Mustard (Sisymbrium altissimum), and Field Pennycress (Thlaspi arvense).

Behavior[edit]

Sexual selection[edit]

In order to increase their reproductive fitness, male P. protodice must select a female who will put his investment to good use. One trait that males select for is bigger size and longer forewing length. It is unknown whether larger females are preferred by males or whether larger females can simply be seen at greater distances than their smaller conspecifics.[7]

Males also tend to prefer younger females with whom they copulate for longer periods of time. The dorsal wing surface of females are partially ultraviolet reflective, especially in older females who have melanic markerkings. [8] As females get older, they tend to accumulate tattering and scale loss which are consequences of increased contact with vegetation during feeding and their search for oviposition sites. Thus, their wings become worn. UV absorbing pigments located on these scales explain the changes in UV reflectance as a female becomes older. Males use this cue to evaluate the age of a female conspecific. It is quite a reliable cue, as the spermatophores of worn females tend to be completely collapsed and empty.[9]

Paternal investment[edit]

It is assumed that many species of male butterflies contribute nothing but sperm to the offspring. Some males, including male P. protodice pass on nutrients along with sperm into the female reproductive tract during copulation. The nutrients contain protein that, can be used by the female for egg production and for somatic maintenance during the female’s search for oviposition sites. This can be thought of as a form of paternal investment.[9] Male secretions are received by the female in the bursa copulatrix which is composed of the corpus bursa and the appendix bursa, the latter of which is filled with a spermatophore containing the sperm and secretions during copulation. During copulation, males on average pass on 7-8% of their precopulatory body mass, with the actual percent of body mass passed inversely correlated with measures of body mass. Therefore, a smaller male must pass on a larger fraction of his body mass in the process. It seems that female size does not influence the quantity of material passed.[9]

Female advancements[edit]

Males are efficient at finding females, making courtship solicitation by females rare. However, female P. protodice have been seen to actively approach and chase both conspecific males and females. When directed at other females, interactions last only a few seconds; however, when directed at males, this behavior is most likely an attempt to solicit male courtship.[10] As a female flies about feeding and searching for oviposition sites, the contents of the spermatophore decreases in size, and the female becomes interested in remating. On average females deplete material received from males in 5 to 7 days.[9] Thus, females who try to solicit courtship only do so when their spermatophore is emptying and they want to receive a fresh batch. Both virgin and previously mated females have been seen to initiate courtships, with various underlying reasons. Virgin females approach males possibly because they are cryptic while perched and must become more conspicuous in their pursuit. However, previously mated females are driven by a different reason, the fact that they are less likely to be attractive to males. As a result they must attempt to elicit courtships to maximize their reproductive options.[10] Another reason encompassing both virgin and previously mated females is that females leave areas of high population density due to male harassment and must actively seek males and adapt to a new environment.

Copulation behavior[edit]

In courtships, females land on exposed perches and the following major events occur: the male contacts the female, the male begins probing, the male abdomen comes between the female’s hindwings, and lastly the male stops moving.[11] Aside from many other butterfly species, P. protodice females lack an abdominal extension response. A male does nothing more than land on a female’s thorax and couple with her. In half of all courtships, females also exhibit a low amplitude flutter response which seems to have no effect on the duration of copulation.[11]

In addition, in situations where they want to fend off a male’s advances, female P. protodice exhibit a rejection behavior, initiated as if they are aware of the presence of a full spermatophore. The females’ wings are fully opened with the tips below the horizontal. In addition, the abdomen is elevated to 45-60 degrees above the body axis and the genitalia are extruded.[12] Interestingly, this rejection posture has often been misconstrued as an invitation to mating, as other butterflies such as the Heliconius use it to attract mates.[13]

Sexual conflict in migration[edit]

In general male pupae develop faster than their conspecific females, and as a result, eclose earlier in the season than females. In addition, they are typically ready to mate within 24 hours of eclosion.[12] This is the reason why there seems to be a high ratio of males to receptive females. In this high-density environment, females are often harassed by males. They will be approached by more than one males at a time within seconds of flight, and the males will often remain in the vicinity for long periods of time. In this situation, females are forced down a gradient of male density, encouraging emigration out of the colony.[6] They will emigrate and colonize new habitats in the process. It is only in instances of increased male death and still emergent females, late in the breeding season, that the numbers balance and no emigration occurs.[12]

Thermoregulatory behavior[edit]

P. protodice require elevated body temperatures of 30-40 degrees Celsius in order to fly, and this is achieved by behavioral orientation to solar radiation. Pieris butterflies, including P. protodice use a behavioral posture for thermoregulation called reflectance basking, in which the wings are used as a sort of biological solar reflector in order to reflect radiation to the body and increase body temperature.[14] In the reflectance basking posture, the dorsal body surface is positioned towards the sun, and the wings are subsequently held open at an angle. The posture suggests that the butterfly is using its white dorsal wing surface to reflect radiation onto their bodies.[5]

See also[edit]

References[edit]

  1. ^ Opler, P. A.; A. D. Warren (2005). "Pontia protodice". Butterflies of North America. Retrieved 16 October 2013. 
  2. ^ "Species Detail BMNA Checkered White". Retrieved 2009-05-19. 
  3. ^ a b c "Pontia protodice". Retrieved 21 November 2013. 
  4. ^ "Attributes of Pontia protodice". Retrieved 8 October 2013. 
  5. ^ a b Shapiro, Arthur M. (1976). "The Biological Status of Nearctic Taxa in the Pieris protodice-occidentalis Group". Lep. Soc. 30 (4): 289–300. 
  6. ^ a b Boisduval; LeConte, Shapiro (1979). "Weather and the Lability of Breeding Populations of the Checkered White Butterfly, Pieris protodice". Journal of Research on the Lepidoptera, 17, 1-23. 17: 1–23. 
  7. ^ Rutowski, Ronald L. (1982). "Epigamic Selection by Males as Evidenced by Courtship Partner Preferences in the Checkered White Butterfly (Pieris protodice)". Animal Behaviour 30: 108–112. doi:10.1016/s0003-3472(82)80243-1. 
  8. ^ Wiernasz, Diane C.; Kingsolver, Joel G. "Wing Melanin Pattern Mediates Species Recognition in Pieris Occidentalis". Animal Behaviour 43 (1): 89–94. doi:10.1016/s0003-3472(05)80074-0. 
  9. ^ a b c d Rutowski, Ronald L. (1984). "Production and Use of Secretions Passed by Males in Pieris protodice". Psyche 91: 141–152. doi:10.1155/1984/58134. 
  10. ^ a b Rutowski, Ronald L. (1980). "Courtship Solicitation by Females of the Checkered White Butterfly, Pieris protodice". Behavioral Ecology and Sociobiology 7 (2): 113–117. doi:10.1007/bf00299516. 
  11. ^ a b Rutowski, Ronald L. (1979). "Courtship Behavior of the Checkered White, Pieris protodice". . Journal of the Leptidopterists’ Society 33 (1): 42–49. 
  12. ^ a b c Shapiro, Arthur M. (1970). "The Role of Sexual Behavior in Density-Related Dispersal of Pierid Butterflies". The American Naturalist 104 (938): 367–372. doi:10.1086/282670. 
  13. ^ Scott, James A. (1972). "Mating of Butterflies". Journal of Research on the Lepidoptera 11 (2): 99–127. 
  14. ^ Kingsolver, Joel G. (1985). Thermal Ecology of Pieris Butterflies: A New Mechanism of Behavioral Thermoregulation=Oecologia (Berlin) 66 (4). pp. 540–545. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!