Overview

Comprehensive Description

The Mussel Worm (Nereis vexillosa) is among the more familiar polychaete ("bristle") worms along the west coast of North America. Like other worms in the family Nereididae, it has two palps on the prostomium ("snout") and four pairs of tenticular cirri arising from the sides of the prostomium in front. Nereis vexillosa is mainly gray in color, but with iridescent green, blue, or even pink. It is found in the intertidal zone with mussels and barnacles, as well as on pilings and under rocks and pieces of wood in quiet bays. (Kozloff 1993; Sheldon 1999; Carlton 2007)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology/Natural History: The large jaws on the distal portion (maxillary ring) of the eversible pharynx are used for seizing prey or tearing algae (Nereids usually eat algae). The smaller denticles on the proximal portion (oral ring) are used for burrowing.

Family Nereididae are called sea nymphs and are common polychaete worms in this area. Intertidal species are sometimes called ragworms. Nereids reproduce by releasing parts of their body as epitokes, which swim to the surface in mating swarms. Nereid epitokes are swollen with eggs or sperm, large parapodia, paddle-like chaetae, and large eyes. Day length is important in swarming of epitokes, and near-shore lights can affect the timing of swarms. In our area, spawning may occur shortly before midnight. The mating swarms release pheromones into the water which induces mating activity. The male epitokes swarm first and the females will not release their eggs unless in the presence of the males. The eggs are released into the water in the swarms, through ruptures in the body walls. In N. vexillosa the female releases an agglutinating material along with her eggs. Both male and female epitokes (heteronereids) die after spawning. The mass, with eggs inside, sinks to the bottom and grows to about the size of a bluish-green chicken egg. Larvae remain as plankton for hours to months. In the Pacific Northwest the mating swarms usually occur in late winter or spring.

This worm is often used for fishing bait. It squirms violently and everts its proboscis and jaws when captured, and may bite.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As a member of Family Nereididae, few if any segments are longer than wide, the notosetae from the two sides do not almost meet along the dorsal midline, the prostomium does not extend as a dorsal caruncle back over the segments posterior to it, there is no circle of tentacles around the mouth, the prostomium has two antennae (photo), and a pair of palps which are differentiated into two units, the distal unit of which is substantial even though it is smaller than the proximal unit (photo). Some of the setae are compound (photo). The pharynx (visible when everted) is delineated into two parts, with a pair of stout jaws on the distal part and conical teeth on both parts. The peristomium has four pairs of tentacular cirri which arise on the anterolateral corners (photo). Usually two pairs of eyes are present. The parapodia on the first two setigers are uniramous, and biramous on all subsequent setigers. Both the notopodia and the neuropodia have acicular lobes which are often small, plus one to three conspicuous lobes above and below the acicular lobes called ligules (photo). The shape and arrangement of the ligules varies among species. In Nereis vexillosa the ventral cirrus of all parapodia is simple, the tentacular cirri of the peristomium are not constricted into several units (photo), the segment behind the peristomium is not expanded into a large collar around the peristomium, all of the paragnaths on the eversible proboscis are conical (not elongated transversely or comblike), some paragnaths are present on the distal part of the proboscis, the posterior notopodia have homogomph falcigerous setae, and the upper ligule of the notopodia in the posterior region is much larger than the lower ligule and is strap-shaped, with a terminal cirrus (photo, easily recognized characteristic). Color is greenish or greenish brown, often with blue tones; may appear iridescent in direct sun. Has 4 black eyes. The tentacular cirri are short (photo). The animal is often large--up to 30 cm long and 1.2 cm wide.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Alaska to San Diego; Pacific coast of Russia

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Like other polychaete annelid worms, Nereis vexillosa has bristly appendages on each of its many segments that help it move about. Its mouthparts, a pair of blackish pincer-like jaws studded with numerous small teeth, can be everted out of its head for feeding (a curious observer may gently press behind the head with thumb and forefinger to encourage the worm to extrude its pharynx when it is not feeding). (Kozloff 1993; Sheldon 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Nereis vexillosa reaches a length of around 15 cm (Kozloff 1993; Sheldon 1999).

According to Johnson (1943), this species can reach 30 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: The large, strap-shaped upper ligule in the posterior notopodia is very helpful in identifying this species. In Nereis grubei and N. neoneanthes the upper ligule of the posterior notopodia is not strap-shaped. Nereis wailesi has no paragnaths on the distal proboscis. Nereis brandti has no homogomphfalcigerous setae on the posterior notopodia and the dorsal ligule of the parapodia is large and leaflike.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 23 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0 - 36
  Temperature range (°C): 9.215 - 10.345
  Nitrate (umol/L): 5.774 - 6.725
  Salinity (PPS): 31.235 - 32.028
  Oxygen (ml/l): 6.535 - 6.794
  Phosphate (umol/l): 0.883 - 0.989
  Silicate (umol/l): 12.975 - 20.289

Graphical representation

Depth range (m): 0 - 36

Temperature range (°C): 9.215 - 10.345

Nitrate (umol/L): 5.774 - 6.725

Salinity (PPS): 31.235 - 32.028

Oxygen (ml/l): 6.535 - 6.794

Phosphate (umol/l): 0.883 - 0.989

Silicate (umol/l): 12.975 - 20.289
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Mid to low intertidal

Habitat: Intertidal with mussels and barnacles, on pilings, in sandy mud and cobbles, and in algal holdfasts.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Nereis vexillosa uses its strong jaws to bite off chunks of seaweed or soft-bodied animals (Brusca and Brusca 1978; Sheldon 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Nereis vexillosa is found along the west coast of North America from Alaska to California (Sheldon 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Johnson (1943) investigated the life history of Nereis vexillosa and his publication should be consulted for detailed information on the life history and development of this species. The tiny eggs produced by Nereis vexillosa are about 0.2 mm in diameter; they are spawned in firm, irregular gelatinoid masses, somewhat translucent, with blue-green, greenish, or brownish tints. These colors are most noticeable in the freshly laid eggs due to their greater compactness prior to absorption of water by the capsular material. The firmness of the masses enables them to withstand a good deal of handling or washing about on the beach by waves without disintegrating. As a result of their robustness, they are often found in good condition on tidal flats where bits of seaweed or other debris collects at the waters edge. However, they seem never to be found in more than moderate quantities despite the fact that N. vexillosa is often quite abundant. According to Johnson (1943), as far as is known the eggs of other Nereis species, and of closely related genera, are deposited separately in the water or are only lightly attached to each other.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

When Nereis vexillosa worms become sexually mature (apparently at 1 year of age), their fleshy parapodia (the lateral, bristle-bearing protrusions on each segment) expand into paddle-like structures for swimming, and periodically during the summer ripe males and females swarm near the surface at night (this behavior can be observed from floating docks if the area is illuminated). The posterior part of the body is typically redder in females than in males. The worms "mate" by spewing sperm and eggs out through openings that develop in the body wall. Observations suggest that the worms die shortly therafter, within a few days or less. (Johnson 1943; Kozloff 1993) In experiments, females ripe with eggs were induced to spawn almost instantly when a few drops of sperm-laden water were added to the water in which they were isolated (Johnson 1943). A spawning female comes to or near the surface and suddenly exudes a mass of eggs, which instantlly clump together. She then then passively sinks to the bottom together with the mass. A few moments later she frees herself from the mass, which remains at the bottom and within a few hours swells to about three or four times its original size through the absorption of water. (Johnson 1943)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nereis vexillosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTTTATATTTTATCTTCGGGATATGATCCGGCCTATTAGGCACTTCAATAAGCCTTTTAATCCGAGCCGAACTCGGGCAACCTGGATCCCTCTTAGGAAGTGACCAGCTATACAACACAATTGTTACAGCCCATGCTTTCCTTATAATTTTCTTCTTAGTTATACCTGTCATGATCGGGGGGTTTGGCAACTGACTAGTCCCCTTAATACTAGGAGCCCCTGACATGGCTTTCCCTCGACTTAACAACATAAGGTTCTGATTGCTACCCCCTTCCCTAACACTTCTTCTATCTAGTGCAGCAGTAGAAAAGGGGGCCGGAACAGGATGAACGGTATACCCCCCACTATCTAGTAACATCGCCCACGCAGGGGCATCAGTTGACTTAGCAATTTTTTCGCTTCATCTAGCAGGAGTCTCTTCGATCATAGGAGCATTAAATTTTATTACAACAGTTATTAATATGCGATCTAAGGGCCTACGTCTGGAACGAGTCTCTCTATTCGTGTGGTCAGTAGTTATTACCGCCGTCCTTTTATTACTAAGGCTTCCTGTCTTAGCAGGGGCTATTACTATATTATTAACTGACCGTAACTTAAACACAGCATTTTTTGACCCTGCTGGAGGAGGGGACCCAGTGTTATACCAACATCTATTCN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nereis vexillosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 36
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nereis vexillosa

Nereis vexillosa belongs to the phylum Annelida, a group known as the segmented worms. It is generally iridescent green and can reach 30 cm in length. It can be distinguished by the size of the upper ligules on the notopodia of the posterior region of the body. The upper ligules are much larger than the lower ligules. It is also without a collar-like structure around the peristomium.[2]

Contents

Habitat [edit]

Sand or rocks in intertidal and shallow marine waters.

Range [edit]

Pacific Ocean from eastern Siberia to western North America as far south as Santa Barbara, California. also found in southern africa.....

Behavior [edit]

Nereis vexillosa is often found in burrows in the sand or in association with mussels and barnacles. Although it has an eversible proboscis that it uses for prey capture, N. vexillosa also feeds on algae which it attaches to the opening of its burrow. The algae also serve to regulate temperature, moisture and salinity during low tide.[3]

Reproduction [edit]

At sexual maturity, N. vexillosa’s body is transformed into a heteronereid or epitoke. This body form is full of gametes and its sole purpose is reproduction. Epitokous worms leave their burrows and enter the water column in spawning swarms. This spawning activity marks the end of the organism’s life cycle.[4]

Importance [edit]

Nereis vexillosa is an important food item for foraging birds in the intertidal zone.[5] The habit of algal attachment to its burrow facilitates the colonization of the alga.[3]

References [edit]

  1. ^ Fauchald, Kristian (2013). "Nereis vexillosa Grube, 1851". World Register of Marine Species. Retrieved 2013-05-17. 
  2. ^ KOZLOFF, E. 1996. Marine invertebrates of the Pacific Northwest, Univ. Wash. Press ISBN 0-295-97562-8
  3. ^ a b WOODIN, S.A. 1977. Algal “gardening” behavior by nereid polychaetes: Effects on soft-bottom community structure. Marine Biology, 44:39-42.
  4. ^ JOHNSON, M. W. 1943. Studies on the life history of the marine annelid Nereis vexillosa. Biological Bulletin, 84:106-114.
  5. ^ WOOTTON , J. T. 1997. Estimates and tests of per capita interaction strength: Diet, abundance, and impact of intertidally foraging birds. Ecological Monographs, 67:45-64.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!