Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphydryas desfontainii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAATAGGAACTTCATTAAGTCTTTTAATTCGAACTGAATTAGGAAATCCAGGTTCATTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGTAATTGATTAATCCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTACTGCCCCCCTCATTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAATTTATCCCCCCCTTTCTTCCAATATTGCCCATAGAGGATCTTCTGTTGATATAACAATTTTCTCATTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGTATCAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCCATTCTTTTATTATTATCACTACCAGTATTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATATTAACACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTNNNNNNNNNNTTTATATTTTAATTTTACCAGTATTTGGTATAATTTCCCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTTTAGGTATAATTTATGCAATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euphydryas desfontainii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Euphydryas desfontainii

The Spanish Fritillary (Euphydryas desfontainii) is a species of butterfly in the Nymphalidae family. It is found in France, Spain,[1] and Morocco (the Rif Mountains and Middle Atlas) and western Algeria in North Africa.[2]

The wingspan is 40–45 mm.[3] Adults are on wing from April to June in one generation per year.[4]

The larvae feed on Dipsacus, Scabiosa, Cephalaria and Knautia species (including Knautia arvensis).[5] The species overwinters in the larval stage. Pupation takes place in spring.

Subspecies[edit]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!