Overview

Brief Summary

North American Ecology (US and Canada)

Vanessa annabella is a resident of the western United States and southwestern Canada and is migratory in some parts of its range (Scott 1986). Habitats are open areas and suburbs. Host plants are herbaceous, and include species from families Malvaceae and Urticaceae (and perhaps others). Eggs are laid on the host plant singly. Individuals overwinter as adults. There are variable numbers of flights each year depending on latitude, with many flights all year in the southern part of their range, two flights in the Rocky Mountains, the first in midsummer, the second in the fall, and one flight in higher mountains (Scott 1986). Some sources consider V. annabella a subspecies of V. carye (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

Most similar to the Painted Lady (V. cardui), but annabella has an orange spot in place of the large white spot two-thirds up the leading edge of the forewing of cardui; annabella is also smaller. There are no named subspecies. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southern British Columbia and Alberta (occassionally straying to eastern Saskatchewan) south to northern Mexico (Layberry et al. 1998, Opler 1999). This species was once considered to be a subspecies of V. carye, which occurs in South America south to Argentina (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Pacific Slope from British Columbia to Baja California. Strays east to the western edge of the Great Plains.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Meadows, fields and pastures, most likley to be found in the southwestern corner of the province.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open, often disturbed areas, wherever its larval hosts, the family Malvaceae and the genus Urtica, occur.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The larvae are known to feed on stinging nettle (Urtica dioica, Urticaceae) and garden hollyhock (Alcea rosea, Malvaceae) in BC (Guppy & Shepard 2001). Almost all other host records are in the Malvaceae (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Common; less so in deserts and high mountains.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar and manure (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Alberta records are primarily from late July to early October.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The pale green eggs are laid singly on the host plant (Scott 1986). the mature larvae can vary in colour from light brown to black, and bear yellow branched spines (Layberry et al. 1998). Like the American and Painted Lady, annabella occurs occasionally as a migrant in Alberta (although never as abundant as the Painted Lady can be). Layberry et al (1998) state annabella is a resident in southwestern Alberta and British Columbia, but all evidence suggests that it is not able to survive the Canadian winters and appears as a spring colonist from further south (Bird et al. 1995, Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Vanessa annabella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Vanessa annabella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TGAGCAGGAATAGTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAACTAGGAAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGACTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATTTCTAGTAGAATTGTTGAAAACGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCAGTAGATTTAGCAATTTTTTCCCTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAGTTAATAGTATATCTTTGGATCAAATACCTTTATTTGTATGAGCTGTAGGTATCACAGCCTTACTTCTTTTATTATCTCTTCCTGTATTAGCTGGAGCTATTACAATACTTTTAACAGATCGAAATATTAATACATCATTTTTCGATCCCGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTNNNNNNNNNNTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTTCCCAAGAAAGAGGAAAAAAGGAAACTTTCGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTATGAGCTCATCACATATTTACAGTAGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, "weedy" species; very common in Calif. cities and suburbs on Malva negecia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

West Coast Lady

The West Coast Lady (Vanessa annabella) is one of three North American species of brush-footed butterflies known colloquially as the "painted ladies". V. annabella occurs throughout much of the western US and south western Canada. The other two species are the cosmopolitan Vanessa cardui (Painted Lady) and the eastern Vanessa virginiensis (American Painted Lady). This species has also been considered a subspecies of the South American Vanessa carye, and is frequently misspelled as anabella.

Contents

Distinguishing features

Schematic of standard wing terminology

Aside from general differences in distribution, V. annabella can be distinguished from the other two painted ladies of North America as follows:

Most conspicuously, it lacks obvious ventral eyespots on the hindwings; there are 2 large ones in V. virginiensis and 4 small ones in V. cardui. Like the latter, it also lacks a white dot in the pinkish/orange subapical field of the ventral/dorsal forewings. Its upperwing coloration has the purest orange of the three; especially the American Painted Lady is usually quite reddish.

A less reliable indicator is the row of black eyespots on the dorsal submarginal hindwing. These are usually of roughly equal size in V. cardui and lack blue centers, though the summer morph may have a few tiny ones. In the other two, usually 2 eyespots are larger and have more conspicuous blue centers. In V. virginiensis, these normally are the spot at each end of the row, whereas in the present species it is the 2 middle ones.

See also Painted_Lady

Picture Gallery

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!