Overview

Brief Summary

North American Ecology (US and Canada)

Vanessa tameamea is a resident of all the main islands of Hawaii only (Scott 1986).  Habitats are montane tropical woods.  Host plants are restricted to species from one family, Urticaceae.  Eggs are laid on the host plant singly.  There are multiple flights all year (Scott 1986).

  • Scott, J.A. 1986. The Butterflies of North America: A Natural History and Field Guide. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© North American Butterfly Knowledge Network

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vanessa tameamea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGCACATTATATTTTATTTTTGGAATTTGAGCAGGGATAGTAGGAACCTCACTTAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATCGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCCTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCATCACTAATATTATTAATCTCTAGTAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGATCATCAGTAGATTTAGCAATTTTTTCTTTGCATTTAGCTGGTATTTCCTCAATCCTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATATATCCTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACAGCCTTACTTCTTTTACTTTCCCTTCCTGTATTAGCTGGAGCTATTACTATACTTCTAACAGATCGAAATATTAATACATCATTTTTTGATCCAGCAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTTTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vanessa tameamea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Kamehameha butterfly

The Kamehameha butterfly (Vanessa tameamea) is one of the two species of butterfly endemic to Hawaii, the other is Udara blackburni.[1] The Hawaiian name is pulelehua. This is today a catch-all native term for all butterflies; its origin seems to be pulelo "to float" or "to undulate in the air" + lehua, a Metrosideros polymorpha flower: an animal that floats through the air, from one lehua to another. Alternatively, it is called lepelepe-o-Hina – roughly, "Hina's fringewing" – which is today also used for the introduced Monarch butterfly.

The Kamehameha butterfly was named the state insect of Hawaii in 2009, due to the work of a group of 5th graders from Pearl Ridge Elementary.[2] These 5th graders (Robyn-Ashley Amano, Ryan Asuka, Kristi Kimura, Jennifer Loui, Toshiro Yanai and Jenna Yanke) proposed the butterfly as the state insect to various legislators as a project for G.T. (Gifted & Talented).

Description[edit]

The caterpillars feed on the leaves of plants in the Urticaceae family,[3] especially those of māmaki (Pipturus albidus)[4] but also ōpuhe (Urera spp.), ʻākōlea (Boehmeria grandis), olonā (Touchardia latifolia), and maʻoloa (Neraudia spp.).[3] Adults eat the sap of koa (Acacia koa) trees.[5]

Taxonomy[edit]

It is named after the royal House of Kamehameha; the last king of this lineage, Kamehameha V, had died in 1872, a short time before this species was described. The specific name tameamea is an old-fashioned and partially wrong transcription of "Kamehameha". The Hawaiian language has no strict distinction between the voiceless alveolar plosive and voiceless velar plosive; use varies from island to island but today "k" is used as the standard transliteration. The voiceless glottal transition "h" is distinct and should always be pronounced - for example, "aloha" is correct whereas "aloa" is a wrong pronunciation. Thus, while "Tamehameha" would be a legitimate transcription (though considered old-fashioned on most islands), "Tameamea" is not.

References[edit]

  1. ^ Oboyski, Peter T. "Kamehameha Butterfly (Vanessa tameamea)". University of California, Berkeley. Retrieved 2009-11-27. 
  2. ^ Cooper, Jeanne (2009-08-21). "Emblems of Hawaii a surprise to many Americans". San Francisco Chronicle. 
  3. ^ a b Scott, James A. (1992). The Butterflies of North America: A Natural History and Field Guide. Stanford University Press. p. 281. ISBN 978-0-8047-2013-7. 
  4. ^ Little Jr., Elbert L.; Roger G. Skolmen (1989). "Mamaki" (PDF). Common Forest Trees of Hawaii (Native and Introduced). United States Forest Service. 
  5. ^ Scott, Susan (1991). Plants and Animals of Hawaii. Bess Press. p. 78. ISBN 978-0-935848-93-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!