Overview

Brief Summary

North American Ecology (US and Canada)

Vanessa tameamea is a resident of all the main islands of Hawaii only (Scott 1986).  Habitats are montane tropical woods.  Host plants are restricted to species from one family, Urticaceae.  Eggs are laid on the host plant singly.  There are multiple flights all year (Scott 1986).

  • Scott, J.A. 1986. The Butterflies of North America: A Natural History and Field Guide. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© North American Butterfly Knowledge Network

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Openings in tropical froest with foodplants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vanessa tameamea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGCACATTATATTTTATTTTTGGAATTTGAGCAGGGATAGTAGGAACCTCACTTAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATCGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCCTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCATCACTAATATTATTAATCTCTAGTAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGATCATCAGTAGATTTAGCAATTTTTTCTTTGCATTTAGCTGGTATTTCCTCAATCCTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATATATCCTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACAGCCTTACTTCTTTTACTTTCCCTTCCTGTATTAGCTGGAGCTATTACTATACTTCTAACAGATCGAAATATTAATACATCATTTTTTGATCCAGCAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTTTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vanessa tameamea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: This is a Hawaiian endemic. Unlike many of these this one is still fairly common but considering all the usual threats there from habitat loss, alien plants, out of control biocontrols (especially parasitoids) etc. the status of this species needs monitoring. Not in immediate danger. Still considered "common" by Howarth et al. (2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Kamehameha butterfly

The Kamehameha butterfly (Vanessa tameamea) is one of the two species of butterfly endemic to Hawaii, the other is Udara blackburni.[1] The Hawaiian name is pulelehua. This is today a catch-all native term for all butterflies; its origin seems to be pulelo "to float" or "to undulate in the air" + lehua, a Metrosideros polymorpha flower: an animal that floats through the air, from one lehua to another. Alternatively, it is called lepelepe-o-Hina – roughly, "Hina's fringewing" – which is today also used for the introduced Monarch butterfly.

The Kamehameha butterfly was named the state insect of Hawaii in 2009, due to the work of a group of 5th graders from Pearl Ridge Elementary.[2] These 5th graders (Robyn-Ashley Amano, Ryan Asuka, Kristi Kimura, Jennifer Loui, Toshiro Yanai and Jenna Yanke) proposed the butterfly as the state insect to various legislators as a project for G.T. (Gifted & Talented).

Description[edit]

The caterpillars feed on the leaves of plants in the Urticaceae family,[3] especially those of māmaki (Pipturus albidus)[4] but also ōpuhe (Urera spp.), ʻākōlea (Boehmeria grandis), olonā (Touchardia latifolia), and maʻoloa (Neraudia spp.).[3] Adults eat the sap of koa (Acacia koa) trees.[5]

Taxonomy[edit]

It is named after the royal House of Kamehameha; the last king of this lineage, Kamehameha V, had died in 1872, a short time before this species was described. The specific name tameamea is an old-fashioned and partially wrong transcription of "Kamehameha". The Hawaiian language has no strict distinction between the voiceless alveolar plosive and voiceless velar plosive; use varies from island to island but today "k" is used as the standard transliteration. The voiceless glottal transition "h" is distinct and should always be pronounced - for example, "aloha" is correct whereas "aloa" is a wrong pronunciation. Thus, while "Tamehameha" would be a legitimate transcription (though considered old-fashioned on most islands), "Tameamea" is not.

References[edit]

  1. ^ Oboyski, Peter T. "Kamehameha Butterfly (Vanessa tameamea)". University of California, Berkeley. Retrieved 2009-11-27. 
  2. ^ Cooper, Jeanne (2009-08-21). "Emblems of Hawaii a surprise to many Americans". San Francisco Chronicle. 
  3. ^ a b Scott, James A. (1992). The Butterflies of North America: A Natural History and Field Guide. Stanford University Press. p. 281. ISBN 978-0-8047-2013-7. 
  4. ^ Little Jr., Elbert L.; Roger G. Skolmen (1989). "Mamaki" (PDF). Common Forest Trees of Hawaii (Native and Introduced). United States Forest Service. 
  5. ^ Scott, Susan (1991). Plants and Animals of Hawaii. Bess Press. p. 78. ISBN 978-0-935848-93-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!