Overview

Brief Summary

Biology

Platynereis dumerilii inbred laboratory strains believed originally collected from inshore near Naples, Italy are used as a model organism in research on genetics, molecular biology, and evolutionary and developmental biology.
  • Zantke, J.; Bannister, S.; Rajan, V. B. V.; Raible, F.; Tessmar-Raible, K. (2014). Genetic and Genomic Tools for the Marine Annelid Platynereis dumerilii. Genetics. 197(1): 19-31.   10.1534/genetics.112.148254 External link.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

Platynereis megalops may be found in Great Harbor and in Eel Pond at Woods Hole, Mass. The swarming heteronereis form is attracted to light and may conveniently be collected with the same type of flat net as is used to obtain Nereis limbata. The sexes are separate. The reddish males swim with rapid, jerky movements' rotating in spirals tangential to the surface of the water. The large females, pale yellow in color, swim slowly at a greater depth. They travel either in a straight line, or, with head bent at right angles to the body, describing a circle about the head (Just, 1914). The males are smaller than those of Nereis limbata (which swarm at the same times) and swim more rapidly. Although it may be somewhat difficult to distinguish these two species when swarming, they are easily differentiated when examined in the laboratory. The eyes of Platynereis are much larger and form conspicuous dark spots on the prostomium, which, unlike that of Nereis, lacks palps and protrudes anterior to the eyes as a transparent, oval lobe.

The animals rarely appear in large swarms, and as a rule, the number appearing during an evening can be easily counted.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomy

  • Two antennae
  • Four pairs of tentacular cirri
  • Pectinate bars and conical paragnaths on both oral and maxillary rings
  • Parapodia biramous
  • Notosetae homogomph spinigers and falcigers, some falcigers forming simple hooks
  • Neurosetae homogomph and heterogomph spinigers
  • Heterogomph falcigers


Diagnostic description
As the rest of annelids, they exhibit two presegmental regions, the prostomium and peristomium, a segmented trunk and a postsegmental pygidium. Several evidence date the origin of polychaetes in the Cambrian era (around 500 millions before present), but some fossil records of larvae from Pre-Cambrian eras show features resembling polychaete larvae.The nuchal organs, a pair of chemosensory structures on the postero-lateral margin of the prostomium, are apparently the only synapomorphic trait of the Polychaeta distinguishes them from other Annelida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Platynereis dumerilii, a marine polychaetous annelid or ragworm.is considered a living fossil. Platynereis dumerilii lives in the same environment as its ancestors millions of years ago and still has many ancestral features. On of the most interesting ancient features this marine worm has retained is an eye like structure called an eyespot. Eyespots are found in the larvae of marine ragworm and are simplest eyes that exist. They resemble the first eyes that developed in animal evolution and allow the larvae to navigate guided by light. Studying the eyespots of Platynereis dumerilii, larva is probably the closest scientists can get to figuring out what eyes looked like when they first evolved.The preserved ancestral features of Platynereis dumerilii, make it useful for many areas of research, particularly developmental evolution. Platynereis dumerilii, is used for the comparison of segmentation between annelids and arthropods, because it comes closer to the putative ancestral morphology and style of development than other model annelids with indirect development.The Platynereis dumerilii are also a good species to use for research as they can be continuously bred in the laboratory.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

Platynereis megalops may be found in Great Harbor and in Eel Pond at Woods Hole, Mass. The swarming heteronereis form is attracted to light and may conveniently be collected with the same type of flat net as is used to obtain Nereis limbata. The sexes are separate. The reddish males swim with rapid, jerky movements' rotating in spirals tangential to the surface of the water. The large females, pale yellow in color, swim slowly at a greater depth. They travel either in a straight line, or, with head bent at right angles to the body, describing a circle about the head (Just, 1914). The males are smaller than those of Nereis limbata (which swarm at the same times) and swim more rapidly. Although it may be somewhat difficult to distinguish these two species when swarming, they are easily differentiated when examined in the laboratory. The eyes of Platynereis are much larger and form conspicuous dark spots on the prostomium, which, unlike that of Nereis, lacks palps and protrudes anterior to the eyes as a transparent, oval lobe.

The animals rarely appear in large swarms, and as a rule, the number appearing during an evening can be easily counted.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

It is a tube-dwelling species characterized by low motility and a semelparous life cycle with a brief pelagic lecithotrophic development.Both male and female undergo epitokous metamorphosis and perform a “nuptial dance” in the water surface, releasing the sperm and eggs synchronously, respectively. This activity is synchronized by pheromones released into the water (Hardege 1999).

Size
They are small in size (length of adult worm up to 6cm).

Life Expectancy
Platynereis dumerilii are marine worms with a relative short life cycle, lasting approximately 3 to 6 months in captivity and up to 2 years in field.

Reproduction
As several polychaetes P. dumerilii are dioecious, (although close species as P. magellensis is hermaphroditic). Gametes are proliferated from a particular germinal epithelium, typically attached to the septa of the anterior segments. Gametogenesis in P. dumerilii lasts 3-5 months in captivity and around 7 month in wild populations, culminating in a single mass broadcast spawning event after epitokous metamorphosis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Also distributed in Australia in Kalk (1958). Tropical Indo-Pacific in Kalk (1958). All other seas, perhaps maybe not Arctic seas (Fishelson and Rullier, 1969).
  • Day, J.H. (1967). Polychaeta of Southern Africa. Part 1. Errantia. British Museum (Natural History), London. 458 & xxix pp.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and ecology

Platynereis dumerilii inhabits shallow hard ocean floors, it is particularly abundant at depths no more than 3m depth. Platynereis dumerilii is widely distributed species found in
  • West Thailand
  • Sri Lanka
  • Java
  • Philippines
  • North Australia
  • South China Sea
Platynereis dumerilii is also very common in Mediterranean and North Atlantic coast of Europe and Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 898 specimens in 4 taxa.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): -0.6 - 25000
  Temperature range (°C): 6.832 - 27.668
  Nitrate (umol/L): 0.033 - 10.898
  Salinity (PPS): 8.500 - 38.444
  Oxygen (ml/l): 3.364 - 7.741
  Phosphate (umol/l): 0.038 - 0.905
  Silicate (umol/l): 0.805 - 40.799

Graphical representation

Depth range (m): -0.6 - 25000

Temperature range (°C): 6.832 - 27.668

Nitrate (umol/L): 0.033 - 10.898

Salinity (PPS): 8.500 - 38.444

Oxygen (ml/l): 3.364 - 7.741

Phosphate (umol/l): 0.038 - 0.905

Silicate (umol/l): 0.805 - 40.799
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 898 specimens in 4 taxa.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): -0.6 - 25000
  Temperature range (°C): 6.832 - 27.668
  Nitrate (umol/L): 0.033 - 10.898
  Salinity (PPS): 8.500 - 38.444
  Oxygen (ml/l): 3.364 - 7.741
  Phosphate (umol/l): 0.038 - 0.905
  Silicate (umol/l): 0.805 - 40.799

Graphical representation

Depth range (m): -0.6 - 25000

Temperature range (°C): 6.832 - 27.668

Nitrate (umol/L): 0.033 - 10.898

Salinity (PPS): 8.500 - 38.444

Oxygen (ml/l): 3.364 - 7.741

Phosphate (umol/l): 0.038 - 0.905

Silicate (umol/l): 0.805 - 40.799
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Later Stages of Development

The larvae resemble those of Nereis limbata.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Later Stages of Development

The larvae resemble those of Nereis limbata.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Fertilization and Cleavage

Insemination follows the curious copulation phenomenon (see the paper by Just, 1914), and is internal; therefore, although the egg is shed in the germinal vesicle stage, it usually has a sperm attached, and a jelly layer and perivitelline space are forming at this time. NO sharply defined fertilization cone is present. Sperm penetration is completed about 30 minutes after egg-extrusion; the middle and tail piece are left outside the egg (Just, 1915b). Development is very similar to that of Nereis limbata.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Unfertilized Ovum

The oöcyte from the body cavity is compressed and irregular. After they are shed, the few uninseminated eggs round up and become nearly spherical, although the polar axis remains slightly shorter than the diameter of the equator. The egg diameter varies somewhat, the largest measuring between 180 and 200 microns. The egg is almost perfectly transparent (much more so than the egg of Nereis limbata), with an equatorial ring of oil drops and a well marked, clear cortex containing very fine granules and striations.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

July, and the first three weeks in August. Platynereis shows a lunar periodicity, appearing in varying numbers from full to new moon. The frequency curve does not correspond precisely to that of Nereis limbata. See the paper of Just (1914) for details of swarming.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fertilization and Cleavage

Insemination follows the curious copulation phenomenon (see the paper by Just, 1914), and is internal; therefore, although the egg is shed in the germinal vesicle stage, it usually has a sperm attached, and a jelly layer and perivitelline space are forming at this time. NO sharply defined fertilization cone is present. Sperm penetration is completed about 30 minutes after egg-extrusion; the middle and tail piece are left outside the egg (Just, 1915b). Development is very similar to that of Nereis limbata.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

The Unfertilized Ovum

The oöcyte from the body cavity is compressed and irregular. After they are shed, the few uninseminated eggs round up and become nearly spherical, although the polar axis remains slightly shorter than the diameter of the equator. The egg diameter varies somewhat, the largest measuring between 180 and 200 microns. The egg is almost perfectly transparent (much more so than the egg of Nereis limbata), with an equatorial ring of oil drops and a well marked, clear cortex containing very fine granules and striations.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

July, and the first three weeks in August. Platynereis shows a lunar periodicity, appearing in varying numbers from full to new moon. The frequency curve does not correspond precisely to that of Nereis limbata. See the paper of Just (1914) for details of swarming.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Rate of Development

NO detailed information is available. Well-formed, swimming trochophores are present in 24 hours; by the seventh day the larvae have three setigerous segments bearing parapodia. After this time, at least one new segment is added daily.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rate of Development

NO detailed information is available. Well-formed, swimming trochophores are present in 24 hours; by the seventh day the larvae have three setigerous segments bearing parapodia. After this time, at least one new segment is added daily.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolution of the eye
Studying the larvae of the marine ragworm Platynereis dumerilii, the scientists found that a nerve connects the photoreceptor cell of the eyespot and the cells that bring about the swimming motion of the larvae.The larvae of marine ragworm Platynereis dumerilii have the simplest eyes that exist. They resemble the first eyes that developed in animal evolution and allow the larvae to navigate guided by lightThe photoreceptor detects light and converts it into an electrical signal that travels down its neural projection, which makes a connection with a band of cells endowed with cilia. These cilia – thin, hair-like projections – beat to displace water and bring about movement.Shining light selectively on one eyespot changes the beating of the adjacent cilia. The resulting local changes in water flow are sufficient to alter the direction of swimming, computer simulations of larval swimming show.The second eyespot cell, the pigment cell, confers the directional sensitivity to light. It absorbs light and casts a shadow over the photoreceptor. The shape of this shadow varies according to the position of the light source and is communicated to the cilia through the signal of the photoreceptor
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Platynereis dumerilii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGCTGATTTTTTTCCACTAATCATAAAGATATTGGCACCTTATACTTCATTTTTGGTACTTGGTCGGGCCTCCTAGGAACCTCTATAAGCCTCTTAATCCGGGCTGAACTAGGTCAACCCGGATCGCTACTCGGGAGA---GACCAACTATATAATACTATTGTTACAGCCCACGCATTCCTAATAATTTTTTTCTTAGTTATACCCGTAATAATCGGAGGGTTTGGCAATTGATTGGTGCCTTTAATATTAGGGGCCCCAGATATAGCATTCCCCCAATTAAATAACATAAGCTTCTGACTTCTTCCCCCCTCTCTGAGTCTTCTTCTTTCTAGGGCAGCAGTAGAAAAAGGAGTGGGTACCGGCTGAACAGTCTATCCTCCTTTATCCAGTAATATTGCTCATGCTGGCCCCTCAGTAGACCTGGCAATCTTTTCTCTTCACCTAGCGGGGGTGTCCTCTATTATAGGGGCCTTAAATTTTATTACCACAGTTATCAATATACGCTCAAAAGGACTAAAACTAGAACGTGTCCCTCTATTTGTATGATCTGTAGTAATTACAGCGGTTCTTCTANTATTAAGGCTTCCAGNGTTAGNGGGTGCTATCACAATATTATTAACAGACCGAAACCTAAACACTGCGTTCTTTGATCCTGCTGGAGGGGGAGACCCAATCCTATACCAGCACTTGTTTTGGTTTTTTGGGCACCCTGAAGTCTACATTCTAATTTTACCAGGATTCGGTATAGTATCCCATATCGTAGCTCATTATTCTAATAAAATAGAAGCCTTTGGCACCCTTGGGATAATTTATGCAATGTTAGGAATTGGGATTCTAGGATTTATTGTATGAGCACATCATATGTTCACAGTAGGAATAGATGTTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Platynereis dumerilii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Preparation of Cultures

The animals should be allowed to mate as soon as possible after collection and the adults removed immediately following shedding. After 20 minutes, decant the water from the dish of eggs and replace with fresh sea water. At the time of the first cleavage, gently break up the jelly-mass and distribute it equally among 7 to 10 fingerbowls of fresh sea water. After about 8 hours, the water should be changed again, and when the trochophores become free-swimming, they should be transferred daily to fresh sea water. The trochophores of this form are markedly sensitive to light, and if too many are kept in one dish, clumping and consequent smothering will occur. One way to prevent this is to keep the larvae in subdued light.

NO feeding is necessary up to the three-somite stage, but as soon as all the endodermal oil drops are absorbed, diatom feeding should be initiated (Just, 1922).

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procuring Gametes

It is imperative to obtain gametes by allowing males and females to mate. Just (1914) succeeded in artificially inseminating eggs only when he mixed "dry" eggs with "dry" sperm. Artificial insemination was not successful, when the eggs were diluted with more than an equal volume of sea water. Mating, fertilization and subsequent egg-extrusion will occur when a male and female are placed together. The mating habits, as described by Just (1914), are of special interest; polyspermy does not ordinarily occur.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

The animals should be isolated in separate fingerbowls of sea water as soon as they are collected. As with Nereis, trays of bowls containing clean sea water and a piece of Ulva should be used. The water should be changed in the laboratory, and the dishes placed on the sea water table.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

This species is a model organism for the lophotrochozoan group (including Phylla as Mollusca, Annelida and Trematoda).P. dumerilii presents several advantageous features:
  • It can be bred in the laboratory
  • Exhibits an ancestral-type body plan
  • Displays indirect development through a ciliated trochophora larva
  • Produces several thousands of offspring in this singular act of spawning
(Arendt et al. 2001)Contain more complete set of ancestral urbilaterian genes and cell types and a less complex development and morphology that can be more easily studied. Model organisms in research (especially in Developmental Biology and Ecotoxicology).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preparation of Cultures

The animals should be allowed to mate as soon as possible after collection and the adults removed immediately following shedding. After 20 minutes, decant the water from the dish of eggs and replace with fresh sea water. At the time of the first cleavage, gently break up the jelly-mass and distribute it equally among 7 to 10 fingerbowls of fresh sea water. After about 8 hours, the water should be changed again, and when the trochophores become free-swimming, they should be transferred daily to fresh sea water. The trochophores of this form are markedly sensitive to light, and if too many are kept in one dish, clumping and consequent smothering will occur. One way to prevent this is to keep the larvae in subdued light.

NO feeding is necessary up to the three-somite stage, but as soon as all the endodermal oil drops are absorbed, diatom feeding should be initiated (Just, 1922).

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Procuring Gametes

It is imperative to obtain gametes by allowing males and females to mate. Just (1914) succeeded in artificially inseminating eggs only when he mixed "dry" eggs with "dry" sperm. Artificial insemination was not successful, when the eggs were diluted with more than an equal volume of sea water. Mating, fertilization and subsequent egg-extrusion will occur when a male and female are placed together. The mating habits, as described by Just (1914), are of special interest; polyspermy does not ordinarily occur.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

The animals should be isolated in separate fingerbowls of sea water as soon as they are collected. As with Nereis, trays of bowls containing clean sea water and a piece of Ulva should be used. The water should be changed in the laboratory, and the dishes placed on the sea water table.

  • Just, E. E., 1915a. An experimental analysis of fertilization in Platynereis megalops. Biol. Bull., 28: 93-114.
  • Just, E. E., 1915b. The morphology of normal fertilization in Platynereis megalops. J. Morph. 26: 217-233.
  • Just, E. E., 1922. On rearing sexually mature Platynereis megalops from eggs. Amer. Nat., 56: 471-478.
  • Just, E. E., 1929. Effects of low temperature on fertilization and development in the egg of Platynereis megalops. Biol. Bull., 57: 439-442.
  • Just, E. E., 1939. The Biology of the Cell Surface. P. Blakiston's Son & Co., Inc., Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!